Chrysococcyx lucidus

(Gmelin, 1788) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Cuculiformes/Cuculidae/Chrysococcyx

At a glance

Occurrence records4 793

Data sources9

Biological traits10

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Chrysococcyx lucidus's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 793 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF4 793 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

The shining bronze-cuckoo (Chrysococcyx lucidus) is a species of cuckoo in the family Cuculidae, found in Australia, Indonesia, New Caledonia, New Zealand, Papua New Guinea, Solomon Islands, and Vanuatu. It was previously also known as Chalcites lucidus. It is the world's smallest cuckoo, being only 15 to in length, and parasitises chiefly dome-shaped nests of various Gerygone species, having a range that largely corresponds with the distribution of that genus. It may also parasitise other Acanthizidae species, and is also the most southerly ranging brood parasitic bird species in the world, extending to at least 46°S in New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraits

Size & morphology3

Body mass24.45 g

Body mass (female)24.5 g

Body mass (male)23.3 g

Life cycle & reproduction2

Egg mass1.73 g

Litter size1

Diet & foraging5

Canopy20 %

Ground20 %

Invertebrate100 %

Midhigh50 %

Understory10 %

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysococcyx lucidus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.47%

Haplotypes2

BIN1

Most divergent pair0.77%

Where individuals differ — all 5 variable positions, in barcode order

87Cvariable

93Tvariable

255Tvariable

471Avariable

561Cvariable

CTAATTTTCGGCGCTTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTACTTATCCGCGCAGAATTAGGCCAACCAGGAACCCTACTCGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cuculus canorussame family9.4%Cuculus optatussame family9.6%Cuculus poliocephalussame family9.7%Urodynamis taitensissame family10.0%Chrysococcyx maculatussame genus11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 793 records

Wild obs. + sensor4 656

Museum / vouchered137

Origin

Native197

Range

Area of Occupancy AOO7 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤1 km 2 254≤10 km 1 691>10 km 413

4 358 georeferenced · 298 without coordinates

Open the mapobservation + sensor4 656

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 1≤1 km 16≤10 km 56>10 km 8

81 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	103
Seattle, US	16
Honolulu, US	6
New Haven, US	2
Vancouver, CA	2
NHMOlocation not on record	2
Wuzhou, CN	1
Bourges, FR	1

8 institutions · 133 of 137 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Chrysococcyx lucidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 13.5–24.0

Seasonal swing summer↔winter8.30 °C

Max temp (day)19.7 °C 16.5–26.2

Min temp (night)15.7 °C 9.60–21.6

Precipitation130 mm/mo 96.8–179

Air humidity62.9 % 61.3–63.1

Moisture balance2.40 mm/mo -51.1–14.0

Vapour deficit805 Pa 582–1,124

Wind speed2.90 m/s 2.60–4.70

Cloud cover33.9 % 31.7–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysococcyx lucidus

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging5

At a glance

Record type4 793 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 793 records