Chrysoclista lathamella

Fletcher, 1936 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Elachistidae/Chrysoclista

At a glance

Occurrence records143

Data sources7

Biological traits2

DNA specimens23

eDNA detections5

Sources7 archives

Databases and archives Chrysoclista lathamella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF143 records

Environmental DNA1 datasets · 4 countries5 detections

DNA & barcodingBOLD23 specimens

01Narrative

Chrysoclista lathamella is a species of moth of the family Agonoxenidae described by Thomas Bainbrigge Fletcher in 1936. It is found in northern Europe (it is not present on the Iberian Peninsula, Balkan Peninsula and Italy). The wingspan is 11–13 mm. Adults are on wing from June to August. The larvae feed on willow (Salix species), probably including white willow (S. alba), crack willow (S. fragilis) and pussy willow (S. caprea). They mine the bark of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysoclista lathamella has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes13

eDNA detections5

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

29Gvariable

46Amostly conserved

58Cvariable

64Cmostly conserved

68Gvariable

82Cvariable

91Cvariable

100Amostly conserved

106Cmostly conserved

133Tmostly conserved

166Amostly conserved

169Avariable

206Cvariable

220Tmostly conserved

235Cvariable

242Avariable

268Tmostly conserved

274Tvariable

318Cmostly conserved

346Amostly conserved

355Cvariable

388Avariable

401Cvariable

403Avariable

421Amostly conserved

439Cvariable

445Tmostly conserved

490Cvariable

506Gmostly conserved

541Tvariable

548Cvariable

562Gvariable

589Tvariable

625Avariable

634Cvariable

646Tmostly conserved

TACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACATCTTTAAGACTCTTAATCCGAGCTGAATTAGGTAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes5

BINs2

Most divergent pair4.4%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysoclista gabreticasame genus9.0%Blastodacna bicristatellasame family9.4%Blastodacna atrasame family9.6%Blastodacna hellerellasame family9.9%Metallarcha beatalissame order9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5Patp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND6MT-NADH5

animal barcodemitochondrialmarker

08Occurrence & distribution

Record type143 records

Wild obs. + sensor104

Museum / vouchered36

Other3

Range

Area of Occupancy AOO412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 25≤1 km 27≤10 km 48>10 km 2

102 georeferenced · 2 without coordinates

Open the mapobservation + sensor104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 7≤1 km 10≤10 km 11

28 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	11
NHMOlocation not on record	5
Tilburg, NL	4
Trondheim, NO	2
SLU Artdatabankenlocation not on record	2
BioFokuslocation not on record	1
South Kensington, GB	1
Helgeland Museum, Natural History Departmentlocation not on record	1

8 institutions · 27 of 36 vouchered records shown · 9 without an institution code

09Environmental DNA5 detections

Where the DNA of Chrysoclista lathamella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 14.7–16.7

Seasonal swing summer↔winter21.7 °C

Max temp (day)19.2 °C 17.1–20.7

Min temp (night)10.0 °C 9.50–14.0

Precipitation95.0 mm/mo 51.1–177

Air humidity60.9 % 55.1–63.2

Moisture balance-13.9 mm/mo -80.4–63.3

Vapour deficit743 Pa 628–810

Wind speed2.10 m/s 1.90–4.30

Cloud cover47.7 % 37.9–60.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)