Chrysochraon dispar

(Germar, 1834) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Chrysochraon

At a glance

Occurrence records74 048

Data sources8

Biological traits0

DNA specimens96

eDNA detections86

Sources8 archives

Databases and archives Chrysochraon dispar's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 048 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics96 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF74 048 records

Environmental DNA1 datasets · 6 countries86 detections

DNA & barcodingBOLD96 specimens

01Narrative

Chrysochraon dispar is a species belonging to the family Acrididae subfamily Gomphocerinae. It is found across the Palearctic east to Siberia .Fauna EuropaeaHeiko Bellmann: Der Kosmos Heuschreckenführer. Die Arten Mitteleuropas sicher bestimmen. Franckh-Kosmos, Stuttgart 2006,

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding96 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysochraon dispar has left across the world's sequence archives.

At a glance

DNA specimens96

BINs1

Marker genes1

eDNA detections86

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

214Tvariable

235Cmostly conserved

308Avariable

406Tvariable

433Amostly conserved

489Amostly conserved

491Cmostly conserved

494Amostly conserved

495Cmostly conserved

496Amostly conserved

498Cmostly conserved

501Tmostly conserved

502Amostly conserved

505Tmostly conserved

506Gmostly conserved

509Tmostly conserved

510Gmostly conserved

511Amostly conserved

512Tmostly conserved

513Cmostly conserved

514Tmostly conserved

515Gmostly conserved

516Tmostly conserved

CACTTTATATTTTATATTTGGAGCCTGATCAGGAATATTAGGAACATCAATAAGTATAATCATTCGTGCAGAGTTAGGACAACCTGGATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes7

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Podismopsis genicularibussame family5.0%Podismopsis poppiusisame family5.6%Leuconemacris litangensissame family7.6%Mongolotettix japonicussame family8.2%Mongolotettix vittatussame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type74 048 records

Wild obs. + sensor72 608

Museum / vouchered1 432

Other8

Origin

Native14 064

Range

Area of Occupancy AOO63 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 14 374≤1 km 3 846≤10 km 46 900>10 km 436

65 556 georeferenced · 7 052 without coordinates

Open the mapobservation + sensor72 608

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 167≤1 km 473≤10 km 618>10 km 3

1 261 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence1 432

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ORTHATlocation not on record	323
Brussel, BE	260
EISlocation not on record	157
MZLUlocation not on record	86
Provincia di Livornolocation not on record	85
Salzburg, AT	69
Tartu, EE	48
Philadelphia, US	41
Geneva, CH	40
University of Tokyo, Department of Zoologylocation not on record	20
Musee d'Histoire Naturallelocation not on record	18
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	18
Stockholm, SE	16
Zürich, CH	13
European Distributed Institute of Taxonomy (EDIT)location not on record	9
Helsinki, FI	7
ZMAAlocation not on record	7
Bern, CH	6
Nijmegen, NL	5
ZSMlocation not on record	5
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	5
Bavarian State Collection of Zoologylocation not on record	4
Natural History Museum Rotterdamlocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Paro, BT	1
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	1
SLU Artdatabankenlocation not on record	1
Champaign, US	1

28 institutions · 1 250 of 1 432 vouchered records shown · 182 without an institution code

09Environmental DNA86 detections

Where the DNA of Chrysochraon dispar was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found86

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 86 detections have coordinates

Open the map6 countries0

mid-forest sandy

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 12.5–20.5

Seasonal swing summer↔winter18.6 °C

Max temp (day)20.7 °C 16.7–24.6

Min temp (night)12.2 °C 8.40–15.2

Precipitation99.1 mm/mo 73.1–197

Air humidity58.9 % 58.3–64.2

Moisture balance-13.9 mm/mo -29.3–64.2

Vapour deficit737 Pa 520–939

Wind speed3.00 m/s 2.40–3.50

Cloud cover34.6 % 33.4–37.5

CHELSA 1981–2010, ~9 km grid, at location & month of 82 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysochraon dispar

At a glance

Sources8 archives

At a glance

Record type74 048 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type74 048 records