Chrysocale regalis

Boisduval, 1836 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Chrysocale

At a glance

Occurrence records154

Data sources6

Biological traits0

DNA specimens6

eDNA detections0

Sources6 archives

Databases and archives Chrysocale regalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility154 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF154 records

DNA & barcodingBOLD6 specimens

01Narrative

Chrysocale regalis is a moth of the subfamily Arctiinae. It was described by Jean Baptiste Boisduval in 1836. It is found in Ecuador and Bolivia.BOLD Systems

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysocale regalis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.25%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 5 variable positions, in barcode order

97Tmostly conserved

463Tmostly conserved

490Tmostly conserved

557Tmostly conserved

578Cmostly conserved

AACACTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysocale ferenssame genus4.3%Macrocneme chrysitissame family5.3%Macrocneme adonissame family5.5%Chrysocale pavasame genus5.5%Macrocneme cabimensissame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type154 records

Wild obs. + sensor153

Museum / vouchered1

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 73≤1 km 28≤10 km 13>10 km 8

122 georeferenced · 31 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	1

1 institutions · 1 of 1 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)