Chrysobothris verdigripennis

Frost, 1910 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Chrysobothris

At a glance

Occurrence records32

Data sources8

Biological traits0

DNA specimens8

eDNA detections10

Sources8 archives

Databases and archives Chrysobothris verdigripennis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF32 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD8 specimens

01Narrative

Chrysobothris verdigripennis is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysobothris verdigripennis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.31%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

190Gmostly conserved

229Amostly conserved

406Cmostly conserved

428Cmostly conserved

475Tmostly conserved

625Gmostly conserved

AACATTATATTTTATTTTTGGAGCTTGGGCAGGAATAGTAGGAACTGCATTAAGATTATTAATTCGGGCTGAATTAGGAAATCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysobothris leechisame genus5.6%Chrysobothris caurinasame genus6.1%Chrysobothris dentipessame genus6.2%Chrysobothris laricissame genus6.2%Chrysobothris scabripennissame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type32 records

Wild obs. + sensor4

Museum / vouchered28

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SOVTlocation not on record	12
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	7
University of Guelphlocation not on record	5
Cambridge, US	1
Royal British Columbia Museumlocation not on record	1
Royal Saskatchewan Museumlocation not on record	1

6 institutions · 27 of 28 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Chrysobothris verdigripennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

UrbanTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 6.10–19.2

Seasonal swing summer↔winter32.0 °C

Max temp (day)18.9 °C 10.7–24.2

Min temp (night)9.90 °C 0.7–15.1

Precipitation89.5 mm/mo 37.5–109

Air humidity57.6 % 53.1–61.0

Moisture balance-59.1 mm/mo -67.6–23.7

Vapour deficit783 Pa 392–976

Wind speed2.40 m/s 1.60–4.40

Cloud cover48.0 % 39.4–56.0

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)