Chrysobothris shawnee

Wellso & Manley, 2007 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Chrysobothris

At a glance

Occurrence records84

Data sources8

Biological traits0

DNA specimens7

eDNA detections2

Sources8 archives

Databases and archives Chrysobothris shawnee's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF84 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD7 specimens

01Narrative

Chrysobothris shawnee is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysobothris shawnee has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P568 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

6Avariable

48Gvariable

63Cvariable

93Avariable

105Cvariable

111Avariable

117Tvariable

129Tvariable

141Cvariable

255Amostly conserved

288Avariable

306Tvariable

310Tvariable

384Tvariable

387Cvariable

393Cvariable

399Amostly conserved

402Avariable

405Amostly conserved

414Tvariable

480Amostly conserved

486Avariable

558Tvariable

GATATAGCATTTCCTCGTATAAATAATATAAGATTTTGATTACTTCCGCCTTCACTTACATTCCTTTTAATAAGAAGAATTGTAGAAAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes7

BIN1

Most divergent pair3.7%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysobothris quadriimpressasame genus1.9%Chrysobothris femoratasame genus3.0%Chrysobothris brevitarsissame genus9.0%Chrysobothris viridicepssame genus9.0%Chrysobothris caurinasame genus10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type84 records

Wild obs. + sensor5

Museum / vouchered79

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1>10 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Central Floridalocation not on record	56
Wuzhou, CN	10
St. Paul, US	6
Denver, US	3
Paris, FR	2
Washington, US	1
US	1

7 institutions · 79 of 79 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Chrysobothris shawnee was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)