Chrysis viridula

Linnaeus, 1761 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Chrysididae/Chrysis

At a glance

Occurrence records2 442

Data sources7

Biological traits2

DNA specimens27

eDNA detections14

Sources7 archives

Databases and archives Chrysis viridula's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 442 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 442 records

Environmental DNA1 datasets · 5 countries14 detections

DNA & barcodingBOLD27 specimens

01Narrative

Chrysis viridula is a Western Palearctic species of cuckoo wasp, first described by Carl Linnaeus in 1761. Chrysis viridula is included in the genus Chrysis, and the family Chrysididae (the cuckoo wasps). It is a parasitoid of a number of species of eumenid wasp, mainly those in the genus Odynerus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)cleptoparasite

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysis viridula has left across the world's sequence archives.

At a glance

DNA specimens27

BINs4

Marker genes1

eDNA detections14

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

22Tmostly conserved

28Amostly conserved

43Tmostly conserved

55Gmostly conserved

76Amostly conserved

79Gmostly conserved

80Amostly conserved

83Tmostly conserved

85Amostly conserved

88Tmostly conserved

94Amostly conserved

110Amostly conserved

121Amostly conserved

181Tmostly conserved

190Gmostly conserved

205Amostly conserved

219Cmostly conserved

229Amostly conserved

253Amostly conserved

256Gmostly conserved

274Amostly conserved

278Tmostly conserved

289Gmostly conserved

301Tmostly conserved

312Tmostly conserved

313Amostly conserved

316Gmostly conserved

322Amostly conserved

334Amostly conserved

343Amostly conserved

356Tmostly conserved

358Amostly conserved

365Amostly conserved

370Tmostly conserved

371Tmostly conserved

448Amostly conserved

455Amostly conserved

471Amostly conserved

475Gmostly conserved

505Amostly conserved

511Amostly conserved

530Cmostly conserved

538Gmostly conserved

544Amostly conserved

553Gmostly conserved

559Amostly conserved

565Amostly conserved

574Amostly conserved

622Amostly conserved

625Gmostly conserved

640Amostly conserved

AATATTATATTTTATTTTTGGTTTATGATCAGGAATAATTGGTACAGGATTAAGGATTTTAATTCGAATAGAATTAAGGATTTCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes3

BINs2

Most divergent pair7.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysis consanguineasame genus7.3%Chrysis daphnissame genus7.8%Chrysis cingulicornissame genus8.5%Chrysura pseudodichroasame family11.1%Chrysis interjectasame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 442 records

Wild obs. + sensor1 305

Museum / vouchered1 137

Range

Area of Occupancy AOO4 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 647≤1 km 263≤10 km 318>10 km 6

1 234 georeferenced · 71 without coordinates

Open the mapobservation + sensor1 305

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 158≤1 km 370≤10 km 376>10 km 4

908 georeferenced · 229 without coordinates

Open the institutions mapphysical evidence1 137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	243
Provincia di Livornolocation not on record	228
Philadelphia, US	137
SLU Artdatabankenlocation not on record	103
NMOKlocation not on record	75
Zürich, CH	75
Muzeum Górnośląskie w Bytomiulocation not on record	53
	31
Natural History Museum Rotterdamlocation not on record	23
MZLUlocation not on record	18
Bonn, DE	18
NHMOlocation not on record	17
Uniwersytet Łódzkilocation not on record	13
University of Tokyo, Department of Zoologylocation not on record	11
NCMGlocation not on record	10
ZMAAlocation not on record	8
Gothenburg, SE	6
NTNU-VMlocation not on record	6
CBDClocation not on record	5
ZSMlocation not on record	4
Trondheim, NO	4
neflocation not on record	3
Tartu, EE	3
I.I. Schmalhausen Institute of Zoologylocation not on record	2
South Kensington, GB	2
Oulu, FI	2
BioFokuslocation not on record	1
Metsähallituslocation not on record	1
Natural History Museum, Londonlocation not on record	1
DFlocation not on record	1
Kuopio, FI	1
Stockholm, SE	1
Ugentlocation not on record	1

33 institutions · 1 107 of 1 137 vouchered records shown · 30 without an institution code

09Environmental DNA14 detections

Where the DNA of Chrysis viridula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 9.60–17.0

Seasonal swing summer↔winter20.1 °C

Max temp (day)17.9 °C 13.7–21.1

Min temp (night)9.90 °C 2.60–12.4

Precipitation88.5 mm/mo 62.3–140

Air humidity58.8 % 57.6–60.9

Moisture balance-27.6 mm/mo -46.1–13.6

Vapour deficit667 Pa 501–779

Wind speed2.60 m/s 2.30–3.70

Cloud cover40.0 % 31.6–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysis viridula

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 442 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 442 records