Chroogomphus tomentosus

(Murrill) O.K.Mill. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Gomphidiaceae/Chroogomphus

At a glance

Occurrence records908

Data sources8

Biological traits0

DNA specimens8

eDNA detections7

Sources8 archives

Databases and archives Chroogomphus tomentosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility908 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF908 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Мокру́ха во́йлочная — вид грибов, входящий в род Хроогомфус (Chroogomphus) семейства Мокруховые (Gomphidiaceae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chroogomphus tomentosus has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP516765.1 ↗737 bpUSA · 2023

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATAAGATTTGGTCGGCGGAAAGGAGGGAGTTGTCGCTGGCCT …

Chroogomphus tomentosus isolate OMDL iNat # 177440597 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type908 records

Wild obs. + sensor742

Museum / vouchered166

Range

Area of Occupancy AOO2 300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 282≤1 km 125≤10 km 117>10 km 98

622 georeferenced · 120 without coordinates

Open the mapobservation + sensor742

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤1 km 14≤10 km 65>10 km 7

86 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	75
Vancouver, CA	35
Bronx, US	10
Ann Arbor, US	8
ILLSlocation not on record	7
Osaka, JP	4
Nagatoro-machi, Chichibu-gun, JP	3
TENN-Flocation not on record	3
Chicago, US	3
Private Collection of Autumn Anglinlocation not on record	2
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1
CA	1
Denver, US	1
Laramie, US	1
California State University, East Baylocation not on record	1

15 institutions · 155 of 166 vouchered records shown · 10 without an institution code

09Environmental DNA7 detections

Where the DNA of Chroogomphus tomentosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 6.20–13.5

Seasonal swing summer↔winter9.90 °C

Max temp (day)12.5 °C 10.0–15.6

Min temp (night)6.40 °C 3.10–11.9

Precipitation228 mm/mo 85.3–338

Air humidity66.6 % 62.6–68.3

Moisture balance310 mm/mo

Vapour deficit409 Pa 318–532

Wind speed2.10 m/s

Cloud cover53.4 % 38.6–62.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)