Chroogomphus ochraceus

(Kauffman) O.K.Mill. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Gomphidiaceae/Chroogomphus

At a glance

Occurrence records310

Data sources6

Biological traits0

DNA specimens1

eDNA detections4

Sources6 archives

Databases and archives Chroogomphus ochraceus's data was compiled from.

GBIFGlobal Biodiversity Information Facility310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF310 records

Environmental DNA2 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chroogomphus ochraceus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAH009858.2 ↗553 bp

ACGT

TCTCCTCCGGGAGGGGGGNACCTATGTCTTTTTCAGACACCACAAGTTTAGAAAGTTCTCAGAATGTTTACTATCGTTCGAGCCGCGACT …

Chroogomphus ochraceus internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; 5.8S ribosomal RNA genes, partial sequence; and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6★ITS1

fungal barcode

08Occurrence & distribution

Record type310 records

Wild obs. + sensor219

Museum / vouchered89

Other2

Origin

Native3

Range

Area of Occupancy AOO928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 70≤1 km 34≤10 km 42>10 km 18

164 georeferenced · 55 without coordinates

Open the mapobservation + sensor219

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 3≤1 km 10≤10 km 22>10 km 2

37 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	14
WTUlocation not on record	10
TENN-Flocation not on record	9
Ann Arbor, US	9
Blacksburg, US	6
JA-CAGPDS-CAMlocation not on record	6
Bronx, US	5
Vancouver, CA	5
St. Paul, US	5
Durham, US	4
Chicago, US	4
Toronto, CA	4
Pullman, US	2
BDBClocation not on record	1
Ciudad de México, MX	1
Copenhagen, DK	1

16 institutions · 86 of 89 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Chroogomphus ochraceus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-10.0 °C -10.0–-10.0

Seasonal swing summer↔winter43.2 °C

Max temp (day)-7.70 °C

Min temp (night)-13.6 °C

Precipitation42.9 mm/mo

Air humidity73.4 %

Moisture balance6.50 mm/mo

Vapour deficit177 Pa

Wind speed2.20 m/s

Cloud cover51.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)