Chromolaichma dalli

(Bergh, 1879) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Chromodorididae/Chromolaichma

At a glance

Occurrence records151

Data sources9

Biological traits4

DNA specimens3

eDNA detections6

Sources9 archives

Databases and archives Chromolaichma dalli's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility109 records↗

OBISOcean Biodiversity Information System42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF · OBIS151 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD3 specimens

01Narrative

Felimida dalli is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Chromodorididae.Bouchet, P. (2012). Felimida dalli. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=597398 on 2012-06-18

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

03Chemical composition2 compounds

Compounds documented for Chromolaichma dalli across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Scalarane sesterterpenoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[(1R,5aS,5bR,7aS,11aS,11bR,13R,13aS)-1-hydroxy-5b,8,8,11a,13a-pentamethyl-1,3,5,5a,6,7,7a,9,10,11,11b,12,13,13b-tetradecahydrophenanthro[2,1-e][2]benzofuran-13-yl] acetate		present	LOTUS
[(1R,5aS,5bR,7aS,11aS,11bR,13S,13aS)-1-hydroxy-5b,8,8,11a,13a-pentamethyl-1,3,5,5a,6,7,7a,9,10,11,11b,12,13,13b-tetradecahydrophenanthro[2,1-e][2]benzofuran-13-yl] acetate		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chromolaichma dalli has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.0%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 10 variable positions, in barcode order

34Avariable

109Tvariable

250Cvariable

340Cvariable

343Gvariable

574Gvariable

580Gvariable

604Tvariable

631Avariable

640Tvariable

AACTCTATACATATTTTTAGGTATATGATGTGGATTAGTAGGTACTGGTTTAAGTTTGTTAATTCGTTTTGAGTTAGGAACTGCTGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Glossodoris hikuerensissame family13.9%Chromodoris striatellasame family14.9%Verconia simplexsame family14.9%Miamira striatasame family15.4%Felimida luteoroseasame family15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type151 records

Wild obs. + sensor96

Museum / vouchered55

Range

Area of Occupancy AOO388 km²

Depth

0–200 m sunlit8

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6.5 m · max 13.3 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 31≤1 km 36≤10 km 10>10 km 1

78 georeferenced · 18 without coordinates

Open the mapobservation + sensor96

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 19≤1 km 9≤10 km 22>10 km 1

51 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	16
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
CASlocation not on record	1
Puerto Ayora, EC	1

4 institutions · 19 of 55 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Chromolaichma dalli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

Arrecife rocoso

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 19.5–26.1

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.3 °C 24.1–27.7

Min temp (night)23.0 °C 14.6–25.2

Precipitation34.7 mm/mo 4.90–244

Air humidity61.4 % 55.1–66.9

Moisture balance-93.3 mm/mo

Vapour deficit1,212 Pa 949–1,227

Wind speed5.70 m/s

Cloud cover25.5 % 15.2–34.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)