Chromodoris willani

Rudman, 1982 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Chromodorididae/Chromodoris

At a glance

Occurrence records1 316

Data sources10

Biological traits4

DNA specimens22

eDNA detections22

Sources10 archives

Databases and archives Chromodoris willani's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 177 records↗

OBISOcean Biodiversity Information System139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS · NPASS35 compounds

Occurrence & distributionGBIF · OBIS1 316 records

Environmental DNA1 datasets · 4 countries22 detections

DNA & barcodingBOLD22 specimens

01Narrative

Chromodoris willani, commonly known as Willan's chromodoris, is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Chromodorididae. The species is named for the renowned nudibranch taxonomist Dr. Richard C. Willan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

03Chemical composition35 compounds

Compounds documented for Chromodoris willani across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids10

Monocarbocyclic sesterterpenoids6

Ursane and Taraxastane triterpenoids5

Cycloartane triterpenoids3

Bauerane triterpenoids3

Documented compounds35 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3R,6S,8S,11R,12R,15R,16R)-7,7,12,16-tetramethyl-15-[(2S)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(E,2Z)-2-[(3R)-3-hydroxy-3-(5-oxo-2H-furan-3-yl)propylidene]-6-methyl-8-(2,6,6-trimethylcyclohexen-1-yl)oct-5-enal	present	LOTUS
(E,2Z)-2-[3-hydroxy-3-(2-hydroxy-5-oxo-2H-furan-3-yl)propylidene]-6-methyl-8-(2,6,6-trimethylcyclohexen-1-yl)oct-5-enal	present	LOTUS
2-[(1S,2S,4aR,4bR,6aR,10S,10aR,10bR,12aR)-1,4a,4b,6a,10-pentamethyl-9-methylidene-2-propan-2-yl-3,4,5,6,7,8,10,10a,10b,11,12,12a-dodecahydro-2H-chrysen-1-yl]acetaldehyde	present	NPASS
2-[(1S,2S,4aR,4bR,6aR,10S,10aR,10bR,12aR)-1,4a,4b,6a,10-pentamethyl-9-methylidene-2-propan-2-yl-3,4,5,6,7,8,10,10a,10b,11,12,12a-dodecahydro-2H-chrysen-1-yl]ethanol	present	NPASS
2-[(1S,2S,4aR,4bR,6aS,10S,10aR,10bR,12aR)-1,4a,4b,6a,9,10-hexamethyl-2-propan-2-yl-2,3,4,5,6,7,10,10a,10b,11,12,12a-dodecahydrochrysen-1-yl]acetaldehyde	present	NPASS
2-[(1S,2S,4aR,4bR,6aS,10S,10aR,10bR,12aR)-1,4a,4b,6a,9,10-hexamethyl-2-propan-2-yl-2,3,4,5,6,7,10,10a,10b,11,12,12a-dodecahydrochrysen-1-yl]ethanol	present	NPASS
2-[(1S,2S,4aR,4bS,6aR,10aS,12aR)-1,4a,4b,6a,9,9-hexamethyl-2-propan-2-yl-3,4,5,6,7,8,10,10a,12,12a-decahydro-2H-chrysen-1-yl]acetaldehyde	present	NPASS
2-[(1S,2S,4aR,4bS,6aR,10aS,12aR)-1,4a,4b,6a,9,9-hexamethyl-2-propan-2-yl-3,4,5,6,7,8,10,10a,12,12a-decahydro-2H-chrysen-1-yl]ethanol	present	NPASS

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chromodoris willani has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections22

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

172Amostly conserved

193Cmostly conserved

301Tmostly conserved

340Tmostly conserved

367Cmostly conserved

494Tmostly conserved

511Gmostly conserved

628Tmostly conserved

AACTTTATACATCTTTTTAGGTATATGATGCGGATTAGTGGGTACAGGGCTGAGACTGCTAATTCGTTTTGAATTAGGAACAGCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes17

BIN1

Most divergent pair1.4%

AsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chromodoris joshisame genus5.8%Chromodoris africanasame genus6.1%Chromodoris hamiltonisame genus6.2%Chromodoris kuiterisame genus6.2%Chromodoris magnificasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 316 records

Wild obs. + sensor1 202

Museum / vouchered114

Origin

Native2

Range

Area of Occupancy AOO1 516 km²

Depth

0–200 m sunlit106

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 55 m · 106 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 329≤1 km 396≤10 km 273>10 km 86

1 084 georeferenced · 118 without coordinates

Open the mapobservation + sensor1 202

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤1 km 11≤10 km 9

20 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZFMK/UNSRATlocation not on record	39
CASlocation not on record	17
Sydney, AU	15
Western Australian Museumlocation not on record	10
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5

5 institutions · 86 of 114 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Chromodoris willani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 20.6–26.0

Seasonal swing summer↔winter0.5 °C

Max temp (day)29.8 °C 23.7–29.8

Min temp (night)22.3 °C 17.5–23.0

Precipitation343 mm/mo 337–348

Air humidity69.6 % 64.7–69.6

Moisture balance205 mm/mo

Vapour deficit1,012 Pa 807–1,063

Wind speed0.6 m/s

Cloud cover57.4 % 44.1–57.4

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chromodoris willani

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Other traits1

Compound class profile5 classes

Documented compounds35 total

At a glance

Record type1 316 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 316 records