Chromocyphella muscicola

(Fr.) Donk · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Chromocyphellaceae/Chromocyphella

At a glance

Occurrence records3 754

Data sources9

Biological traits0

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Chromocyphella muscicola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 754 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 754 records

Environmental DNA2 datasets · 4 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Chromocyphella muscicola is a fungus of the genus Chromocyphella. It is cup-shaped, with an upper surface covered with fine hairs and a smooth underside. The species reaches a diameter of about 4 mm across. It was first described as Cyphella muscicola by Elias Fries in 1822, and was transferred to the newly erected genus, Chromocyphylla, in 1959 by Marinus Anton Donk.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chromocyphella muscicola has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences7

eDNA detections6

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMF623836.1 ↗604 bpSpain · 2016

ACGT

TTATTGAATGAACTTGGCGTGTTGTAGCTGGTCCTTCTGGACATTGTGCTCGCTCGTCATTTTTATCTCTCCACCTGTGCACACATTGTA …

Chromocyphella muscicola voucher ARAN-Fungi 3210 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type3 754 records

Wild obs. + sensor3 613

Museum / vouchered141

Range

Area of Occupancy AOO6 504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 886≤1 km 124≤10 km 2 264>10 km 27

3 301 georeferenced · 312 without coordinates

Open the mapobservation + sensor3 613

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 28≤1 km 19≤10 km 25

72 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Sebastián, ES	20
Kew, GB	16
Universidade de Lisboa, Museu Bocagelocation not on record	13
Copenhagen, DK	13
Karlsruhe, DE	7
Museo Entomologico de Leonlocation not on record	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Görlitz, DE	4
Trondheim, NO	4
Tilburg, NL	3
California State University, East Baylocation not on record	3
SLU Artdatabankenlocation not on record	3
Olocation not on record	2
WU-MYClocation not on record	2
Bronx, US	1
Mlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
Gijón, ES	1
Auckland, NZ	1
Kyiv, UA	1
Canberra, AU	1

22 institutions · 107 of 141 vouchered records shown · 34 without an institution code

09Environmental DNA6 detections

Where the DNA of Chromocyphella muscicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map4 countries0

Eldre humid lÃ¸vskog; pÃ¥ bark av ospForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.3 °C 2.70–17.7

Seasonal swing summer↔winter13.7 °C

Max temp (day)13.5 °C 4.60–23.6

Min temp (night)6.50 °C -0.6–13.7

Precipitation90.9 mm/mo 23.7–298

Air humidity58.8 % 54.6–70.7

Moisture balance8.00 mm/mo -104–261

Vapour deficit388 Pa 288–912

Wind speed3.00 m/s 1.70–5.00

Cloud cover46.1 % 27.9–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chromocyphella muscicola

At a glance

Sources9 archives

At a glance

Record type3 754 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 754 records