Chondrilla juncea
speciesAt a glance
Occurrence records60 141
Data sources12
Biological traits68
DNA specimens11
eDNA detections8
Sources12 archives
Databases and archives Chondrilla juncea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility60 141 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources68 traits
Chemical compositionNPASS4 compounds
Occurrence & distributionGBIF60 141 records
Environmental DNA1 datasets · 3 countries8 detections
DNA & barcodingBOLD · NCBI11 specimens
Genome at a glanceCCDB1.4 Gbp
01Narrative
قندرون خشن الأوبار هو نوع من النباتات يتبع جنس القندرون من الفصيلة النجمية.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Fruit length9 mm
Fruit length max9 mm
Fruit length min8 mm
Leaf length120 mm
Leaf length max200 mm
Leaf length min40 mm
Leaf mass23.62 mg
Leaf mass per area74.3 g/m2
Leaf size301 mm²
Leaf width32.5 mm
⚠ sources differ — AusTraits: 32.5 mm · GIFT: 13 mm
Leaf width max50 mm
Leaf width min15 mm
Plant height0.575 m
⚠ sources differ — GIFT: 0.575 m · AusTraits: 1 m · LEDA: 0.5 m · TRY: 0.568 m
Plant height generative0.595 m
Plant height max1.3 m
Plant height min0.3 m
Seed length8.5 mm
⚠ sources differ — TRY: 8.5 mm · GIFT: 3.3 mm
Seed length max3.3 mm
Seed length min3.3 mm
Seed mass0.451 mg
⚠ sources differ — TRY: 0.451 mg · LEDA: 0.69 mg · GIFT: 0.574 mg
Seed mass max0.49 mg
Seed mass min0.48 mg
Life cycle & reproduction17
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: agochor · GIFT: anemochorous
Flower colouryellow
Flowering endAug
Flowering startJul
Flowering timeyyyynnnnnnny
Life formperennial
Life spanperennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Resprouting capacityresprouts
Seed number616
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 300 m
Elevation mean1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFThills, mountains, sand, stony places
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate linear oblanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio19.83 g/g
Leaf c427 mg/g
Leaf dry-matter content (LDMC)208 mg/g
Leaf n21.53 mg/g
Leaf p2.36 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)13.69 mm²/mg
⚠ sources differ — TRY: 13.69 mm²/mg · LEDA: 7.53 mm²/mg · GIFT: 7.53 mm²/mg
Other traits3
Diaspore typeone-seeded generative dispersule
Plant support typefree-standing
Shoot orientationerect
03Chemical composition4 compounds
Compounds documented for Chondrilla juncea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Documented compounds4 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 24-Methylenecholest-4-En-3-Beta,6Beta-Diol | present | NPASS | |
| AZOQCLUPGYXSJW-FJPRSBCFSA-N | present | NPASS | |
| SCHSEISSFMEKOL-CCSNDEMQSA-N | present | NPASS | |
| SCHSEISSFMEKOL-YMKGBVBFSA-N | present | NPASS |
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chondrilla juncea has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes6
GenBank sequences10
eDNA detections8
Countries6
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTTGAGGGCACGCCTGCCTGGGCGTCACACATCGTGTTGCTCCA …
Chondrilla juncea var. juncea voucher PLT.0205 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★trnL-F★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Chondrilla juncea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 409 053 500 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Chondrilla juncea1.41 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy3× triploid · measured
Chromosome records14–302n range20median20mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1557×CCDB · ita-fl · CCDB · slov-fl · CCDB · iber-fl +8
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — BATTAGLIA E. - 1949. L'alterazione della meiosi nella riproduzione apomittica di Chondrilla juncea L.. Caryologia , 2(1): 23-30.
CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1983. Numeros cromosomaticos de plantas occidentales, 200-210.. Anales Jard. Bot. Madrid , 39(2): 519-524.
CCDB · ita-fl — BRULLO S., PAVONE P. - 1978. Numeri cromosomici per la flora italiana:464-483.. Inform. Bot. Ital. , 10(2): 248-264.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · poland — Ko?ci?ska-Paj?k M. 2006. Biologia rozmna?ania apomiktycznych gatunkw Chondrilla juncea L., Chondrilla brevirostris L. i Taraxacum alatum Lindb. z uwzgl?dnieniem bada? ultrastrukturalnych i immunocytochemicznych. KonTekst, Krakw.
CCDB · poland — Jankun A., Ma?ecka J., Izmai?ow R., Wcis?o H., Czapik R., Musia? K., et al. 1996 Further studies in chromosome numbers of Polish Angiosperms. Part XXV. Acta Biol. Cracov. Ser. Bot. 38, 9-27.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Nazarova, E. A. 1984. Chromosome numbers in the Caucasian representatives of the families Asteraceae, Brassicaceae, Fabaceae, Limoniaceae. Bot. Zhurn. SSSR 69(7): 972–975. (In Russian).
CCDB · ipcn-api-dl — Ghaffari, S. M. 1987. Chromosome studies in some flowering plants of Iran. Rev. Cytol. Biol. Vég., Bot. 10: 3–8.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Magulaev, A. Y. 1992. Chromosome numbers in some species of vascular plants of the northern Caucasus flora. Bot. Žhurn. (Moscow & Leningrad) 77(10): 88–90.
CCDB · ipcn-api-dl — Krahulcová, A. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Parra, R., B. Valdés, A. Álvarez, J. Villarreal & J. Roldán. 1998. Números cromosómicos para la flora española. 793--805. Lagascalia 20(2): 302–308.
CCDB · ipcn-api-dl — Sokolovskaya, A. P. & N. S. Probatova. 1980. Chromosome numbers in some species from the sands of SaryLum (Daghestan ASSR). Bot. Zhurn. 65 (8): 1169–1172.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — LOON VAN, J. C. & H. D. JONG. 1978. In IOPB chromosome number reports LIX. Taxon 27: 53–61.
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Tomb, A. S., K. L. Chambers, D. W. KYHOS, A. M. Powell & P. H. RAVEN. 1978. Chromosome numbers in the Compositae XIV. Lactuceae. Amer. J. Bot. 65: 717–721.
CCDB · ipcn-api-dl — Krasnikov, A. A., O. S. Zhirova, M. N. Lomonosova & S. V. Smirnov. 2003. Chromosome numbers of Asteraceae from the southern Siberia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 88(9): 151–153.
CCDB · ipcn-api-dl — Nazarova. 2004. Pages 1--171 in Chromosome Numbers of Flowering Plants of Armenian Flora. Yerevan.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn73-74 — KUZMANOV, B.A.,M.E., ANCHEV. 1973. In IOPB chromosome number reports XLI. Taxon 22: 459-464
CCDB · eflora
CCDB · book-fedorov — Fiop;p;y6Hali-ApHOJil>)U! 1933a
CCDB · book-fedorov — MOAAfOHaH-ApBOilbAH 1933a
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Bergman 19441>, 1!!52a
CCDB · book-fedorov — Battaglia 1949d
CCDB · book-fedorov — Uhrikova, Cincura
CCDB · book-fedorov — I. Slov. fl. I. 1967)
CCDB · book-atlas-flowering-plants — Battaglia 1949
CCDB · CromoCat 2015 — Battaglia, E. (1949c). L'alterazione della meiosi nella riproduzioni apomittica di Chondrilla juncea. Caryologia 2: 23-30.
CCDB · CromoCat 2015 — Bergman, B. (1944). A contribution to the knowledge of the embryo sac mother cell and its development in two apomicts. Svensk Bot. Tidskr. 38: 249-259.
CCDB · CromoCat 2015 — Bergman, B. (1950). Meiosis in two different clones of the apomictic Chondrilla juncea. Hereditas 36: 297-320.
CCDB · CromoCat 2015 — Bergman, B. (1952). Chromosome morphological studies in Chondrilla juncea and some remarks on the microsporogenesis. Hereditas 38: 128-130.
+16 more references
2n 142×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Buttler, K. P. 1989. Chromosomenzahlen von Gefässpflanzen aus Hessen 4. Folge. Hess. Florist. Briefe 38: 11–14.
CCDB · CromoCat 2015 — Buttler, K. P. (1989). Chromosomenzahlen von Gefässpflanzen aus Hessen 4. Folge. Hess. Florist. Briefe 38: 11-14.
2n 202×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · CromoCat 2015 — Probatova, N.S., Seledets, V.P., Rudyka, E.G., Gnutikov, A.A., Kozhevnikova, Z.V. & Barkalov V.Y. (2009). IAPT/IOPB Chromosome Data 8 Taxon 58 (4): 1284-1288
2n 301×CCDB · book-fedorov
CCDB · book-fedorov — Delay 1947
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
triploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.859 ↗
08Occurrence & distribution
Record type60 141 records
Wild obs. + sensor54 370
Museum / vouchered4 348
Cultivated / captive11
Other1 412
Origin
Native2 623
Introduced9 394
Range
Area of Occupancy AOO98 252 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy44% within 1 km
≤100 m 11 537≤1 km 6 323≤10 km 22 415>10 km 383
40 658 georeferenced · 13 712 without coordinates
Open the mapobservation + sensor54 370
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 366≤1 km 621≤10 km 872>10 km 70
1 929 georeferenced · 2 419 without coordinates
Open the institutions mapphysical evidence4 348
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 10 without coordinates
Open the mapnot free-living11
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions110 of 193 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 418 |
| BIO-UNIPIlocation not on record | 371 |
| Uniwersytet Wrocławskilocation not on record | 212 |
| Moscow State Universitylocation not on record | 163 |
| BFLlocation not on record | 135 |
| Adelaide, AU | 99 |
| Mount Annan, AU | 88 |
| BDBClocation not on record | 80 |
| Canadian Department of Agriculturelocation not on record | 77 |
| BClocation not on record | 75 |
| Museo Entomologico de Leonlocation not on record | 72 |
| LDlocation not on record | 68 |
| Canberra, AU | 66 |
| Adam Mickiewicz University in Poznańlocation not on record | 66 |
| Kensington, AU | 64 |
| Görlitz, DE | 63 |
| MAlocation not on record | 49 |
| Zürich, CH | 42 |
| Philadelphia, US | 41 |
| LfUlocation not on record | 40 |
| València, ES | 40 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 40 |
| Zürich, CH | 39 |
| Riverside, US | 37 |
| College of the Atlantic, Museumlocation not on record | 35 |
| Uniwersytet Warszawskilocation not on record | 33 |
| CJBGlocation not on record | 32 |
| GJOlocation not on record | 32 |
| University of Stellenboschlocation not on record | 32 |
| ISAlocation not on record | 31 |
| WTUlocation not on record | 30 |
| Barcelona, ES | 29 |
| Jaén, ES | 28 |
| Wlocation not on record | 28 |
| San Luis Obispo, US | 27 |
| Madrid, ES | 27 |
| Brisbane, AU | 27 |
| Entomological Society of Latvialocation not on record | 26 |
| BRNUlocation not on record | 25 |
| Regensburgische Botanische Gesellschaftlocation not on record | 24 |
| Bronx, US | 24 |
| CICYTEXlocation not on record | 24 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 23 |
| College Park, US | 23 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 23 |
| PRClocation not on record | 22 |
| Badajoz, ES | 22 |
| Moscow, US | 22 |
| Bern, CH | 21 |
| IDElocation not on record | 20 |
| Córdoba, ES | 19 |
| Salamanca, ES | 19 |
| Davis, US | 19 |
| Vitoria, ES | 19 |
| Pullman, US | 19 |
| Mlocation not on record | 18 |
| Ann Arbor, US | 17 |
| Chongqing Museumlocation not on record | 15 |
| Corvallis, US | 15 |
| Armidale, AU | 14 |
| Provincia di Livornolocation not on record | 13 |
| Allentown, US | 12 |
| Paris, FR | 12 |
| Granada, ES | 11 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 11 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| Claremont, US | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Caldwell, US | 9 |
| Nijmegen, NL | 9 |
| San Sebastián, ES | 9 |
| Kew, GB | 9 |
| Auckland, NZ | 9 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 9 |
| Dresden, DE | 9 |
| Boise, US | 9 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 8 |
| Lausanne, CH | 8 |
| Alicante, ES | 8 |
| Portland, US | 7 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 7 |
| Oskarshamn, SE | 7 |
| Santa Barbara, US | 7 |
| San Diego, US | 7 |
| MeiseBGlocation not on record | 7 |
| BGBMlocation not on record | 6 |
| Rishon Le Zion, IL | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| GZUlocation not on record | 6 |
| John May Museum of Natural Historylocation not on record | 6 |
| John T. Waterhouse Herbariumlocation not on record | 6 |
| EEZA-CSIClocation not on record | 6 |
| Karlsruhe, DE | 5 |
| Bourges, FR | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Vancouver, CA | 5 |
| Pamplona, ES | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Logan, US | 4 |
| Wuzhou, CN | 4 |
| No collectionlocation not on record | 4 |
| New Brunswick, US | 4 |
| Missoula, US | 4 |
| Bangkok, TH | 4 |
| Cheney, US | 4 |
| McWane Science Centerlocation not on record | 4 |
| Pamplona, ES | 4 |
| Los Angeles, US | 4 |
| H-Schuhwlocation not on record | 4 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Bozeman, US | 3 |
| University of Bayreuthlocation not on record | 3 |
| Victoria, CA | 3 |
| Frankfurt am Main | 3 |
| CASlocation not on record | 3 |
| Millersville, US | 3 |
| Parkville, AU | 3 |
| Sevilla, ES | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Porrentruy, CH | 3 |
| Washington, US | 2 |
| Arcata, US | 2 |
| UIBlocation not on record | 2 |
| Hobart, AU | 2 |
| Stockholm, SE | 2 |
| Palacký University in Olomouclocation not on record | 2 |
| Williamsburg, US | 2 |
| JBSlocation not on record | 2 |
| Beijing, CN | 2 |
| RJBJCIlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| Bratislava, SK | 2 |
| Burlington, US | 2 |
| Frauenfeld, CH | 2 |
| Québec, CA | 2 |
| Fairfax, US | 2 |
| NLD037location not on record | 2 |
| CJBNlocation not on record | 2 |
| Christchurch, NZ | 2 |
| Salzburg, AT | 2 |
| Bend, US | 2 |
| Harrisonburg, US | 2 |
| Davenport, US | 2 |
| Durban, ZA | 1 |
| Phoenix, US | 1 |
| San Isidro, AR | 1 |
| Castelar, AR | 1 |
| AUAlocation not on record | 1 |
| Provo, US | 1 |
| Mississippi State, US | 1 |
| Henderson, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Mexico City, MX | 1 |
| Dekalb, US | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Podgorica, ME | 1 |
| Taipei, TW | 1 |
| Wellington, NZ | 1 |
| ESP004location not on record | 1 |
| UBT-Kaullocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| ER-Gaucklocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Northridge, US | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Pretoria, ZA | 1 |
| ER Hellerlocation not on record | 1 |
| ER Kochlocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Uppsala, SE | 1 |
| Coimbra, PT | 1 |
| Macomb, US | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Whitehorse, CA | 1 |
| Flagstaff, US | 1 |
| Chapel Hill, US | 1 |
| ASUlocation not on record | 1 |
| Göteborg, SE | 1 |
| KNFYlocation not on record | 1 |
| Brussel, BE | 1 |
| Sion, CH | 1 |
| Bloomington, US | 1 |
| Edinburgh, GB | 1 |
| La Trobe Universitylocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| US | 1 |
| Musée des Confluenceslocation not on record | 1 |
193 institutions · 3 783 of 4 348 vouchered records shown · 519 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA8 detections
Where the DNA of Chondrilla juncea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 9.10–18.5
Seasonal swing summer↔winter19.6 °C
Max temp (day)18.9 °C 14.3–23.8
Min temp (night)9.30 °C 4.10–12.2
Precipitation72.1 mm/mo 43.8–72.2
Air humidity56.7 % 53.5–58.3
Moisture balance-20.6 mm/mo -99.2–-19.0
Vapour deficit782 Pa 548–1,019
Wind speed2.70 m/s 2.60–4.10
Cloud cover40.9 % 36.7–45.3
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.