Choanephora cucurbitarum

(Berk. & Ravenel) Thaxt. · species

image placeholder — illustration coming later

Fungi/Mucoromycota/Mucoromycetes/Mucorales/Choanephoraceae/Choanephora

At a glance

Occurrence records143

Data sources9

Biological traits0

DNA specimens0

eDNA detections88

Sources9 archives

Databases and archives Choanephora cucurbitarum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF143 records

Environmental DNA6 datasets · 11 countries88 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈35 Mbp

01Narrative

Choanephora cucurbitarum is a fungal plant pathogen that causes fruit and blossom rot of various cucurbits. It can also affect okra, snap bean, and southern pea, and may cause a stem and leaf rot of Withania somnifera. Recently Das et al. 2017 added few more patho-index on aubergine (Solanum melongena L.), teasle gourd (Momordica subangulata Blume subsp. renigera (G. Don) de Wilde, hyacinth bean (Lablab purpureus (L.) Sweet), green pea (Pisum sativum) from India. Wet weather, high temperature and high humidity favor disease development from inoculum that is typically soil-borne. Signs of infection on fruits or leaves include water-soaked, necrotic lesions, which progress rapidly under ideal conditions. As the fungus begins to produce spores, affected tissues become dark grey-brown and hairy as a result of the superficial sporangia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Choanephora cucurbitarum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections88

Countries11

The DNA barcodea real sequence read deposited for this species

ITSMH856791.1 ↗565 bp

ACGT

CATTAAATAAATAAGAAGTATTTCGGGCTTGTCCTGATCTACTATCTATTTTACTGTGAACTGTTTTATTTCATGGCGTTTGAGGGATGT …

Choanephora cucurbitarum strain CBS 150.51 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Choanephora cucurbitarum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈35 108 735 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Choanephora cucurbitarum0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness91.7% BUSCO

08Occurrence & distribution

Record type143 records

Wild obs. + sensor4

Museum / vouchered139

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2≤10 km 1

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 1≤1 km 1≤10 km 10>10 km 3

15 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	13
Bernard Price Institute for Palaeontological Researchlocation not on record	11
DPIlocation not on record	7
Auckland, NZ	5
Lincoln, US	2
Catholic University of Pekinglocation not on record	2
Chapel Hill, US	1
UAclocation not on record	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1

9 institutions · 43 of 139 vouchered records shown · 96 without an institution code

09Environmental DNA88 detections

Where the DNA of Choanephora cucurbitarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys6

Countries11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map11 countries0

AfrotropicNeotropicIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH7.42

Conductivity47,850 µS/cm

Organic carbon6.68 %

Clay18.7 %

Sand36.3 %

Depth0 m

SoilVertosol

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 22.4–28.9

Seasonal swing summer↔winter5.10 °C

Max temp (day)31.4 °C 26.2–35.5

Min temp (night)21.2 °C 17.3–24.0

Precipitation68.5 mm/mo 3.60–243

Air humidity57.4 % 44.0–72.2

Moisture balance-72.6 mm/mo -160–104

Vapour deficit1,394 Pa 921–2,013

Wind speed2.60 m/s 0.7–3.10

Cloud cover19.6 % 13.7–55.6

CHELSA 1981–2010, ~9 km grid, at location & month of 87 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)