Chlorodes boisduvalaria

(Le Guillou, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Chlorodes

At a glance

Occurrence records178

Data sources8

Biological traits0

DNA specimens12

eDNA detections11

Sources8 archives

Databases and archives Chlorodes boisduvalaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility178 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF178 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Chlorodes is a monotypic moth genus in the family Geometridae erected by Achille Guenée in 1857. Its only species, Chlorodes boisduvalaria, or Boisduval's emerald, first described by Élie Jean François Le Guillou in 1841, is known from Australia, including Tasmania.Australian Faunal Directory

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chlorodes boisduvalaria has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

28Amostly conserved

202Gmostly conserved

229Amostly conserved

271Tmostly conserved

316Gmostly conserved

433Amostly conserved

451Amostly conserved

517Cmostly conserved

578Tvariable

AACATTATATTTTATTTTTGGTGTTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes3

BIN1

Most divergent pair0.30%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eucyclodes gracililineasame family7.0%Phallaria ophiusariasame family7.1%Eucyclodes speciosasame family7.1%Eucyclodes metaspilasame family7.3%Lithostege usgentariasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type178 records

Wild obs. + sensor114

Museum / vouchered64

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 34≤1 km 45≤10 km 15>10 km 5

99 georeferenced · 15 without coordinates

Open the mapobservation + sensor114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 30≤10 km 3>10 km 1

34 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	32
Museums Victorialocation not on record	20
Australian National Fish Collectionlocation not on record	3
Australian National Insect Collectionlocation not on record	3
QVMAGlocation not on record	1

5 institutions · 59 of 64 vouchered records shown · 5 without an institution code

09Environmental DNA11 detections

Where the DNA of Chlorodes boisduvalaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 11.9–19.8

Seasonal swing summer↔winter8.50 °C

Max temp (day)19.2 °C 15.4–25.1

Min temp (night)11.6 °C 9.10–14.2

Precipitation53.4 mm/mo 44.3–152

Air humidity58.5 % 57.2–64.1

Moisture balance-44.8 mm/mo -73.8–55.7

Vapour deficit704 Pa 566–845

Wind speed3.60 m/s 1.60–4.10

Cloud cover30.3 % 22.1–31.9

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)