Chlorochroa juniperina

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Chlorochroa

At a glance

Occurrence records2 496

Data sources7

Biological traits0

DNA specimens10

eDNA detections0

Sources7 archives

Databases and archives Chlorochroa juniperina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 496 records↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 496 records

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT2n = 14

01Narrative

Chlorochroa juniperina is a European species of shield bug in the tribe Nezarini. C. juniperina is distributed in mainland Europe from France through to Scandinavia, but became extinct in England in 1925 due to the decline of juniper, its host.The Species Recovery Trust Lost Life Project The plate below shows C. juniperina - "Pentantoma juniperina Linn" (bottom-right) in The Hemiptera Heteroptera of the British Islands.Edward Saunders (1892) The Hemiptera Heteroptera of the British Islands: a descriptive account of the families, genera, and species indigenous to Great Britain and Ireland : with notes as to localities & habitats.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chlorochroa juniperina has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

97Tmostly conserved

100Tmostly conserved

110Amostly conserved

163Gmostly conserved

187Tvariable

263Tmostly conserved

280Amostly conserved

483Cmostly conserved

505Tmostly conserved

550Gmostly conserved

631Gmostly conserved

634Tmostly conserved

AACTTTATATTTCCTATTTGGAATATGAGCTGGAATAGTAGGATCAGCTATAAGATTAATCATTCGTATTGAATTAGGACAACCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes5

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chlorochroa rossianasame genus9.4%Chlorochroa ligatasame genus9.9%Chlorochroa uhlerisame genus11.4%Zicrona caeruleasame family11.6%Thyanta accerrasame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Chlorochroa juniperina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 496 records

Wild obs. + sensor2 060

Museum / vouchered410

Other26

Range

Area of Occupancy AOO6 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 746≤1 km 422≤10 km 571>10 km 15

1 754 georeferenced · 306 without coordinates

Open the mapobservation + sensor2 060

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 64≤1 km 102≤10 km 204>10 km 9

379 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence410

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	110
Tartu, EE	30
SLU Artdatabankenlocation not on record	25
Philadelphia, US	13
ZMAAlocation not on record	9
Tallinn, EE	8
Jyväskylä, FI	8
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	6
Tromsø, NO	4
Helsinki, FI	2
Metsähallituslocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
NEFlocation not on record	1
ZSMlocation not on record	1
Copenhagen, DK	1
NCMGlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
neflocation not on record	1

18 institutions · 224 of 410 vouchered records shown · 186 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chlorochroa juniperina

At a glance

Sources7 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 496 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 18 geolocated

Record type2 496 records