Chloris virgata
Sw. · speciesAt a glance
Occurrence records9 882
Data sources9
Biological traits50
DNA specimens75
eDNA detections38
Sources9 archives
Databases and archives Chloris virgata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 882 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics75 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources50 traits
Occurrence & distributionGBIF9 882 records
Environmental DNA1 datasets · 7 countries38 detections
DNA & barcodingBOLD · NCBI75 specimens
Genome at a glanceCCDB2n = 20
01Narrative
Chloris virgata é uma espécie de planta com flor pertencente à família Poaceae. A autoridade científica da espécie é Sw., tendo sido publicada em Flora Indiae Occidentalis 1: 203. 1797.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology12
Fruit length1.75 mm
Leaf length200 mm
Leaf mass8 mg
Leaf mass per area110 g/m2
Leaf size1 054 mm²
⚠ sources differ — TRY: 1 054 mm² · AusTraits: 337 mm²
Leaf width3.55 mm
Plant height0.45 m
⚠ sources differ — AusTraits: 0.45 m · TRY: 0.39 m
Plant height max1.2 m
Plant height min0.12 m
Seed mass0.228 mg
⚠ sources differ — TRY: 0.228 mg · AusTraits: 0.2 mg · GIFT: 0.219 mg
Seed mass max0.41 mg
Seed mass min0.1 mg
Life cycle & reproduction11
DeciduousnessN
Dispersal typewind
Flowering endAug
Flowering startFeb
Flowering timeyynnnnnnnnny
Life formannual or perennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual short_lived_perennial · GIFT: annual
Pollination syndromewind
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 800 m
Elevation mean817 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo de Várzea
Leaf compoundnesssimple
Leaf formlinear
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio23.68 g/g
Leaf c439 mg/g
Leaf dry-matter content (LDMC)334 mg/g
Leaf n18.96 mg/g
Leaf p2.84 mg/g
Photosynthetic pathwayC4
Specific leaf area (SLA)24.84 mm²/mg
Wood density436 mg/cm³
Other traits3
Leaf marginentire
Leaf spinesno
Leaf thornsno
05DNA & barcoding75 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chloris virgata has left across the world's sequence archives.
At a glance
DNA specimens75
Marker genes7
GenBank sequences10
eDNA detections38
Countries9
The DNA barcodea real sequence read deposited for this species
ACGCAAGTTGCGCCTAAGGTCTTTTGGCCAAGGGCACGTCTGCCTGGGCGTCACGCCAAAAGACACTCCACACCAATCCTGGTATGGATG …
Chloris virgata voucher REC457 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL2★rbcLa★trnL★trnL-F★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Chloris virgata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome records14–402n range20median20mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2016×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +4
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · book-ipcn66 — Snigh & Godward 1960; Gould 1966
CCDB · book-ipcn72 — MESICEK, J., & J. SOJAK. 1972. Chromosome studies in Mongolian plants. Preslia 44: 334-358.
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-indian_vol2 — Moffett, A.A. & Hurcombe, R. 1949 ; Brown, W.V. 1950, 1951 ; Singh, D.N. & Godward, M.B.E. 1960; Pritchard, A.J. & Gould, K.F. 1964 ; Gould, F.W. 1966, 1968; Gupta, P.K. 1969a, 1971 ; Malik, C.P. & Tripathi, R.C. 1970 ; Mesicek, J. & Sojak, J. 1972 ; Davidse, G. & Pohl, R.W. 1972b; Trouin, M. 1972
CCDB · book-fedorov — Moffett, Hurcombe 1949
CCDB · book-fedorov — Brown W. V. 1950, 1951
CCDB · book-fedorov — Singh D. N., Godward 1960
CCDB · book-fedorov — Pritchard A. J., Gould 1964 (I. 1964)
CCDB · book-fedorov — Gould 1966
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · iapt — IAPT/IOPB Chromosome Data 18
CCDB · iapt — IAPT/IOPB Chromosome Data 26
CCDB · iapt — IAPT/IOPB Chromosome Data 27
2n 142×CCDB · book-indian_vol2 · CCDB · book-fedorov
CCDB · book-indian_vol2 — Nielsen, E.L. & Humphary, L.M. 1937
CCDB · book-fedorov — Nielsen E. L., Humphrey 1937
2n 262×CCDB · book-indian_vol2 · CCDB · book-fedorov
CCDB · book-indian_vol2 — Thomas (D. 1955)
CCDB · book-fedorov — Thomas (D. 1955)
2n 302×CCDB · book-indian_vol2 · CCDB · book-fedorov
CCDB · book-indian_vol2 — Krishnaswamy, N. 1941
CCDB · book-fedorov — Krishnaswamy 1941
2n 402×CCDB · book-indian_vol2 · CCDB · book-fedorov
CCDB · book-indian_vol2 — Krishnaswamy, N. 1941
CCDB · book-fedorov — Krishnaswamy 1941
2n 361×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Rao, P. N. & L. B. Mwasumbi. 1981a. In Chromosome number reports LXXII. Taxon 30: 701.
n 1011×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +1
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · ipcn-api-dl — Sahni, M. & S. S. Bir. 1985. SOCGI plant chromosome number reports -- III. J. Cytol. Genet. 20: 205–206.
CCDB · ipcn-api-dl — Spies, J. J. & A. Jonker. 1987. Chromosome studies on African plants. 4. Bothalia 17: 135–136.
CCDB · ipcn-api-dl — Strydom, A. & J. J. Spies. 1994. A cytotaxonomic study of some representatives of the tribe Cynodonteae (Chloridoideae). Bothalia 24(1): 92–96.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2002. Chromosome studies on African plants. 18. The subfamily Chloridoideae. Bothalia 32(2): 240–249.
CCDB · ipcn-api-dl — Rao, P. N. & L. B. Mwasumbi. 1981a. In Chromosome number reports LXXII. Taxon 30: 701.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2003. Chromosome studies in the grass subfamily Chloridoideae. II. An analysis of polyploidy. Taxon 52(4): 736–746.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2003. Chromosome studies in the grass subfamily Chloridoideae. I. Basic chromosome numbers. Taxon 52(3): 557–566.
CCDB · book-ipcn66 — Snigh & Godward 1960; Gould 1966
CCDB · book-ipcn72 — DAVIDSE, G., & R.W. POHL. 1972. Chromosome numbers, meiotic behavior, and notes on some grasses from Central America and the West Indies. Canad. J. Bot. 50: 1441-1452.
CCDB · book-ipcn72 — GUPTA, P.K. 1971. Cytological investigations in some North Indian grasses. Genet. Iber. 23: 183-198.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type9 882 records
Wild obs. + sensor3 125
Museum / vouchered6 530
Cultivated / captive32
Other195
Origin
Native160
Introduced661
Range
Area of Occupancy AOO27 236 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 1 397≤1 km 330≤10 km 189>10 km 89
2 005 georeferenced · 1 120 without coordinates
Open the mapobservation + sensor3 125
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 991≤1 km 445≤10 km 781>10 km 198
2 415 georeferenced · 4 115 without coordinates
Open the institutions mapphysical evidence6 530
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 31 without coordinates
Open the mapnot free-living32
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions199 of 368 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Pretoria, ZA | 609 |
| Beijing, CN | 269 |
| Saint Louis, US | 266 |
| University of Stellenboschlocation not on record | 240 |
| Brisbane, AU | 217 |
| Durango, MX | 182 |
| Austin, US | 161 |
| Wuzhou, CN | 147 |
| Adelaide, AU | 131 |
| ASUlocation not on record | 126 |
| Canberra, AU | 110 |
| Kew, GB | 104 |
| San Diego, US | 99 |
| Guasave, MX | 93 |
| Mount Annan, AU | 93 |
| Bronx, US | 78 |
| Palmerston, AU | 78 |
| San Isidro, AR | 77 |
| Ann Arbor, US | 74 |
| Kensington, AU | 73 |
| Flagstaff, US | 70 |
| Albuquerque, US | 69 |
| Fort Worth, US | 66 |
| Riverside, US | 66 |
| Chengdu, CN | 61 |
| Córdoba, AR | 59 |
| Museo Entomologico de Leonlocation not on record | 56 |
| EL PASO, US | 53 |
| Zacatecas, MX | 52 |
| Mexico City, MX | 48 |
| Davis, US | 46 |
| Claremont, US | 46 |
| La Paz, MX | 46 |
| Mexico City, MX | 45 |
| Yangling, CN | 45 |
| Phoenix, US | 44 |
| MeiseBGlocation not on record | 41 |
| Puerto Ayora, EC | 41 |
| Xining, CN | 40 |
| KMCClocation not on record | 40 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 39 |
| NSMKlocation not on record | 36 |
| Juriquilla, MX | 35 |
| Chengdu, CN | 33 |
| Xiamen, CN | 33 |
| Kunming, CN | 32 |
| Ciudad de México, MX | 31 |
| Ciudad de México, MX | 31 |
| Lubbock, US | 29 |
| Chapingo, MX | 29 |
| Logan, US | 29 |
| Denver, US | 29 |
| Baroda, IN | 28 |
| Castelar, AR | 28 |
| Fundación Miguel Lillolocation not on record | 26 |
| Chongqing Museumlocation not on record | 26 |
| Urumqi, CN | 26 |
| Santa Barbara, US | 23 |
| Laboratory of Palaeontologylocation not on record | 23 |
| Hermosillo, MX | 22 |
| Canadian Department of Agriculturelocation not on record | 22 |
| Durban, ZA | 21 |
| UFERSAlocation not on record | 20 |
| Zhengzhou, CN | 19 |
| Mendoza, AR | 19 |
| Tampa, US | 19 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 19 |
| Paris, FR | 19 |
| Cape Town, ZA | 19 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 18 |
| Aarhus, DK | 18 |
| Tlalnepantla, MX | 18 |
| Austin, US | 17 |
| Nanjing, CN | 17 |
| Adam Mickiewicz University in Poznańlocation not on record | 17 |
| Sanda, JP | 17 |
| Odawara, JP | 16 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 16 |
| BISHlocation not on record | 16 |
| Mérida, MX | 15 |
| LDlocation not on record | 15 |
| Moscow State Universitylocation not on record | 15 |
| Bloomington, US | 14 |
| San Luis Potosí, MX | 14 |
| San Luis Obispo, US | 14 |
| BClocation not on record | 13 |
| Frankfurt am Main | 13 |
| Torreón, MX | 13 |
| QAUlocation not on record | 13 |
| Jackson, US | 13 |
| Ciudad Juárez, MX | 12 |
| Seoul, KR | 12 |
| Provo, US | 12 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 12 |
| BAYLUlocation not on record | 12 |
| DOI/NPS, Greenbelt Parklocation not on record | 12 |
| Ciudad Autónoma de Buenos Aires, AR | 12 |
| Armidale, AU | 11 |
| National Institute of Biological Resourceslocation not on record | 11 |
| Inner Mongolia Universitylocation not on record | 11 |
| ENTClocation not on record | 11 |
| Guangzhou, CN | 11 |
| Smithfield, AU | 10 |
| Salta, AR | 10 |
| UNIVASFlocation not on record | 10 |
| Antiguo Cuscatlán, SV | 10 |
| Stockholm, SE | 10 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 10 |
| Lanzhou, CN | 9 |
| GZUlocation not on record | 9 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 9 |
| Berlin, DE | 9 |
| San Angelo, US | 9 |
| AUAlocation not on record | 9 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 9 |
| Corrientes, AR | 9 |
| Uppsala, SE | 8 |
| Kyoto Universitylocation not on record | 8 |
| BAlocation not on record | 8 |
| Hobart, AU | 8 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 8 |
| Jiangxi College of Educationlocation not on record | 8 |
| Chicago, US | 8 |
| Fredericton Stock Culture Collectionlocation not on record | 8 |
| Grand Junction, US | 8 |
| Plocation not on record | 7 |
| Little Rock, US | 7 |
| Cape Town, ZA | 7 |
| Instituto de Investigação Científica Tropicallocation not on record | 7 |
| Tianjin Natural History Museumlocation not on record | 7 |
| Shanxi Institute of Biologylocation not on record | 7 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 7 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 7 |
| Shenyang Agricultural Universitylocation not on record | 6 |
| University of Southern Mississippilocation not on record | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| Yunnan Universitylocation not on record | 6 |
| Henderson, US | 6 |
| Laboratorio de Ictiologialocation not on record | 6 |
| CASlocation not on record | 6 |
| Honolulu, US | 6 |
| Awka, NG | 6 |
| GB | 6 |
| GMBAlocation not on record | 6 |
| USFSlocation not on record | 6 |
| California Academy of Scienceslocation not on record | 6 |
| Universidad Nacional de La Pampalocation not on record | 5 |
| Herbarium of South China Botanical Gardenlocation not on record | 5 |
| Museu Paraense Emílio Goeldilocation not on record | 5 |
| Taipei, TW | 5 |
| DanBIFlocation not on record | 5 |
| SXTCMlocation not on record | 5 |
| Masindi, UG | 5 |
| Universidade Federal de Sergipe (UFS)location not on record | 5 |
| TAIElocation not on record | 5 |
| Giardini Botanici Hanburylocation not on record | 5 |
| Mexico City, MX | 5 |
| Xian, CN | 5 |
| Tsukuba, JP | 5 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 5 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 5 |
| Bangkok, TH | 5 |
| WNNUlocation not on record | 5 |
| CIIDIRlocation not on record | 5 |
| TAFORI-LSRClocation not on record | 5 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 5 |
| Cenargenlocation not on record | 4 |
| Shanghai, CN | 4 |
| Texas A&M Universitylocation not on record | 4 |
| Auckland, NZ | 4 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 4 |
| Kirksville, US | 4 |
| Chiba, JP | 4 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 4 |
| Texas Lutheran Universitylocation not on record | 4 |
| Dresden, DE | 4 |
| Tomioka, JP | 4 |
| The University of Arizonalocation not on record | 4 |
| Autlán de Navarro, MX | 4 |
| Tuscaloosa, US | 4 |
| Beijing, CN | 4 |
| Bern, CH | 4 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 4 |
| Severin-McDaniel Insect Collectionlocation not on record | 4 |
| Beijing Normal Universitylocation not on record | 4 |
| Edinburgh, GB | 4 |
| James Cook Townsvillelocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Toyama, JP | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| WAGlocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Ensenada, MX | 3 |
| Montecillo, Texcoco, MX | 3 |
| Universidad Nacional del Litorallocation not on record | 3 |
| Mississippi State, US | 3 |
| Angwin, US | 3 |
| Brasília, BR | 3 |
| Arcata, US | 3 |
| Pittsburg, US | 3 |
| Chadron, US | 3 |
| Moscow, US | 3 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Osaka, JP | 3 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 3 |
| Burlington, US | 3 |
| Cusco, PE | 3 |
| KR | 3 |
| JBRJlocation not on record | 3 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 3 |
| Los Angeles, US | 3 |
| Xinxiang, CN | 3 |
| San Francisco de Campeche, MX | 3 |
| Taipei, TW | 3 |
| Brasília, BR | 3 |
| Pullman, US | 3 |
| GAlocation not on record | 3 |
| Urumqi, CN | 3 |
| Haramaya Universitylocation not on record | 3 |
| University of New Hampshirelocation not on record | 2 |
| Sagamihara, JP | 2 |
| Durango, US | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| Orem, US | 2 |
| New Mexico State Universitylocation not on record | 2 |
| HACAMlocation not on record | 2 |
| Culiacán, MX | 2 |
| Feira de Santana, BR | 2 |
| Universidad de Buenos Aireslocation not on record | 2 |
| Vancouver, CA | 2 |
| Boise, US | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Fayetteville, US | 2 |
| South Kensington, GB | 2 |
| Chaguaramas, TT | 2 |
| Edmonton, CA | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| Hebei Normal Universitylocation not on record | 2 |
| Yaoundé, CM | 2 |
| Clocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Universidad Nacional de San Luislocation not on record | 2 |
| LINUlocation not on record | 2 |
| UnBlocation not on record | 2 |
| Mérida, MX | 2 |
| Philadelphia, US | 2 |
| Cambridge, US | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| Addis Ababa, ET | 2 |
| IMMUlocation not on record | 2 |
| Tapachula, MX | 2 |
| Riobamba, EC | 2 |
| Puebla, MX | 2 |
| Olocation not on record | 2 |
| Denton, US | 2 |
| Shanghai, CN | 2 |
| Stroud Water Research Centerlocation not on record | 2 |
| US | 2 |
| Kochi, JP | 2 |
| València, ES | 2 |
| BIO-UNIPIlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| South African National Parks, Scientific Services, Kruger National Parklocation not on record | 2 |
| Tokushima, JP | 1 |
| University of Alberta Museumslocation not on record | 1 |
| MSB-3054location not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Loja, EC | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Guilin, CN | 1 |
| Shanxi Universitylocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Chapel Hill, US | 1 |
| BDBClocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Columbia, US | 1 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 1 |
| Christchurch, NZ | 1 |
| HCIBlocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| International Salmonella Centre (W.H.O.)location not on record | 1 |
| Bando, JP | 1 |
| MEXUlocation not on record | 1 |
| EAlocation not on record | 1 |
| Universidad de Autonoma de Baja Californialocation not on record | 1 |
| Durham, US | 1 |
| Elocation not on record | 1 |
| Macomb, US | 1 |
| Corvallis, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Montréal, CA | 1 |
| Taipei, TW | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| PRClocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Northridge, US | 1 |
| DSMlocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Tempe, US | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| MCNAMlocation not on record | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Calabar, NG | 1 |
| Philadelphia, US | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| Arusha, TZ | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Zürich, CH | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| Lincoln, US | 1 |
| UFMSlocation not on record | 1 |
| LNBG$location not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| IPA/SPlocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Batemans Bay, AU | 1 |
| Stephenville, US | 1 |
| Chengdu, CN | 1 |
| Dehra Dun, IN | 1 |
| León, NI | 1 |
| Iquitos, PE | 1 |
| Tulane Universitylocation not on record | 1 |
| La Paz, BO | 1 |
| UMKClocation not on record | 1 |
| Cochabamba, BO | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| BGPAlocation not on record | 1 |
| UFRPElocation not on record | 1 |
| Norfolk, US | 1 |
| BRNUlocation not on record | 1 |
| Barcelona, ES | 1 |
| UFESlocation not on record | 1 |
| Knoxville, US | 1 |
| UFPElocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Podgorica, ME | 1 |
| Oskarshamn, SE | 1 |
| Carter County Museumlocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Helsinki, FI | 1 |
| US | 1 |
| KURAlocation not on record | 1 |
| UFPIlocation not on record | 1 |
| Mlocation not on record | 1 |
| Mexico City, MX | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Williamsburg, US | 1 |
| Wlocation not on record | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Toluca, MX | 1 |
| Mazatlán, MX | 1 |
| Irvine, US | 1 |
368 institutions · 6 302 of 6 530 vouchered records shown · 225 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA38 detections
Where the DNA of Chloris virgata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found38
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 38 detections have coordinates
Open the map7 countries0
Roadsides along highwaysRed soil savanna bushland.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.8 °C 16.7–26.2
Seasonal swing summer↔winter8.20 °C
Max temp (day)24.2 °C 22.0–31.1
Min temp (night)14.9 °C 11.2–21.3
Precipitation50.4 mm/mo 10.6–85.6
Air humidity56.8 % 42.1–63.5
Moisture balance-82.3 mm/mo -150–-29.9
Vapour deficit981 Pa 787–1,883
Wind speed3.00 m/s 1.90–4.80
Cloud cover34.8 % 25.5–41.8
CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.