Chloris divaricata — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Chloris

At a glance

Occurrence records589

Data sources7

Biological traits32

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Chloris divaricata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility589 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF589 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

垂穗虎尾草（学名：）为禾本科虎尾草屬下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length2 mm

Leaf length110 mm

Leaf size81 mm²

Leaf width1.75 mm

Plant height0.5 m

Plant height max0.5 m

Seed length1.85 mm

Seed mass0.112 mg

Seed mass max0.11 mg

Seed mass min0.11 mg

Life cycle & reproduction7

Dispersal typewind

Flowering timeyynnnnnnnyyy

Life formperennial

Life spanperennial

Pollination syndromewind

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: tussock

Habitat GIFTSavanna, halophytic vegetation, dense secondary shrub and ruderal vegetation

Leaf compoundnesssimple

Succulenceno

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chloris divaricata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences7

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMH752514.1 ↗606 bpAustralia

ACGT

TGTCATCTATGCTGCCGTTTGATGGGCCTTGCACCCATCTCTCGGTCTAGGCTGCCAACCTTCTTTCAGAGGGATGGTTTGCCAAAAGAA …

Chloris divaricata var. cynodontoides isolate Fahey, P.S. 10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS7

fungal barcode

08Occurrence & distribution

Record type589 records

Wild obs. + sensor172

Museum / vouchered251

Other166

Origin

Native57

Range

Area of Occupancy AOO1 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 55≤1 km 12≤10 km 22>10 km 13

102 georeferenced · 70 without coordinates

Open the mapobservation + sensor172

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 30≤1 km 25≤10 km 63>10 km 10

128 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence251

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	55
Paris, FR	35
Brisbane, AU	30
MeiseBGlocation not on record	11
Palmerston, AU	8
Canberra, AU	7
Odawara, JP	7
Nishihara, JP	7
Adelaide, AU	6
Auckland, NZ	5
TAIElocation not on record	5
Kew, GB	5
LDlocation not on record	5
BISHlocation not on record	5
Saint Louis, US	5
Museo Entomologico de Leonlocation not on record	4
Armidale, AU	4
Taipei, TW	4
Honolulu, US	3
BRNUlocation not on record	3
Hobart, AU	3
Nishihara, JP	3
Bloomington, US	3
Smithfield, AU	2
Tsukuba, JP	2
Bern, CH	2
Uppsala, SE	2
Wollongong, AU	1
BAYLUlocation not on record	1
Wlocation not on record	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Sanda, JP	1
SLU Artdatabankenlocation not on record	1
Helsinki, FI	1
Zürich, CH	1
Christchurch, NZ	1

36 institutions · 240 of 251 vouchered records shown · 11 without an institution code

09Environmental DNA1 detections

Where the DNA of Chloris divaricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.