Chlorella vulgaris

Beij. · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Trebouxiophyceae/Chlorellales/Chlorellaceae/Chlorella

At a glance

Occurrence records262

Data sources10

Biological traits0

DNA specimens43

eDNA detections107

Sources10 archives

Databases and archives Chlorella vulgaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS64 compounds

Occurrence & distributionGBIF262 records

Environmental DNA7 datasets · 12 countries107 detections

DNA & barcodingBOLD · NCBI43 specimens

Genome at a glanceGoaT · NCBI26 Mbp

01Narrative

Chlorella vulgaris est une espèce d'algues vertes unicellulaire microscopique de la famille des Chlorellaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition64 compounds

Compounds documented for Chlorella vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cholestane steroids $ Ergostane steroids9

Carotenoids (C40, Ψ-Ψ)6

Carotenoids (C40, β-ε)6

Carotenoids (C40, β-β)5

Glycosyldiacylglycerols5

Documented compounds64 total

Tissue Source Quantified only

Compound	Amount	Source
(18E)-2,6,10,14,19,23,27,31-octamethyldotriaconta-2,6,10,14,16,18,22,26,30-nonaene	present	LOTUS
(1R)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(4R)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol	present	LOTUS
(1R)-4-[(1E,3Z,5E,7E,9E,11E,13E,15E,17E)-3-(hydroxymethyl)-18-[(1S,4R)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-7,12,16-trimethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol	present	LOTUS
(1S)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(1R,4S)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol	present	LOTUS
(1S)-4-[(1E,3E,5E,7E,9E,11Z,13E,15E,17E)-12-(hydroxymethyl)-18-[(1R,4S)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,16-trimethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol	present	LOTUS
(3beta,22Z)-Stigmasta-5,22-dien-3-yl acetate	present	LOTUS
(3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol	present	LOTUS
(9-cis,9'-cis)-7,7',8,8'-Tetrahydro-y,y-Carotene	present	LOTUS
(9S,10E,12Z,15Z)-9-hydroperoxy-10,12,15-octadecadienoate	present	LOTUS
(9Z,11E)-(13S)-13-hydroperoxyoctadeca-9,11-dienoate	present	LOTUS

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chlorella vulgaris has left across the world's sequence archives.

At a glance

DNA specimens43

Marker genes5

GenBank sequences10

eDNA detections107

Countries12

The DNA barcodea real sequence read deposited for this species

ITSPZ352993.1 ↗250 bpUzbekistan · 2024

ACGT

GCTCACCCCCTCGCCTCCCCATCTCCTTTGATTGGGAAGGCGGATCTGACCTTCCCGGTTCCGCCGGTCACTCGTGATTGGCGCCGGGTC …

Chlorella vulgaris strain VKM Al-563 internal transcribed spacer 2, partial sequence

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL1★ITS916S18S

animal barcodeplant barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_045362 ↗ · 35 protein · 27 tRNA · 3 rRNA

nad9atp6rps11rps13rpl6rpl5cox1orf251orf184nad4nad5atp4atp8cox2cox3nad7coborf139atp9rps3rpl16rps19rps10nad2rps7rps12+12

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Chlorella vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size26 346 122 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Chlorella vulgaris0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness94.6% BUSCO

08Occurrence & distribution

Record type262 records

Wild obs. + sensor132

Museum / vouchered104

Cultivated / captive5

Other21

Origin

Native8

Range

Area of Occupancy AOO704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 56≤1 km 10≤10 km 6

72 georeferenced · 60 without coordinates

Open the mapobservation + sensor132

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 1≤1 km 4≤10 km 1

6 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence104

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	3
KULlocation not on record	3
TASHlocation not on record	1
Uppsala, SE	1
Universidad de Antioquia (UdeA)location not on record	1

5 institutions · 9 of 104 vouchered records shown · 90 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA107 detections

Where the DNA of Chlorella vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found107

Studies independent surveys7

Countries12

Verifiable raw sequence linked38

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 107 detections have coordinates

Open the map12 countries0

Palearcticfreshwater cultured contaminated with Spirul…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature2.38 °C

Salinity34.6 PSU

Dissolved oxygen5.55 mg/L

Depth965 m

Pelagic

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 1.10–16.5

Seasonal swing summer↔winter15.6 °C

Max temp (day)13.2 °C 3.10–19.7

Min temp (night)6.40 °C -1.40–13.3

Precipitation75.6 mm/mo 52.7–116

Air humidity63.3 % 58.8–67.7

Moisture balance0.4 mm/mo

Vapour deficit506 Pa 216–733

Wind speed4.40 m/s

Cloud cover51.4 % 38.9–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 74 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)