Chloanthes parviflora

Walp. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Chloanthes

At a glance

Occurrence records1 109

Data sources7

Biological traits37

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Chloanthes parviflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 109 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF1 109 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Habit near the Sandstone Caves Chloanthes parviflora is a species of flowering plant in the family Lamiaceae. It is a small, rounded shrub with dark green, linear leaves and mauve tubular flowers. It grows in New South Wales and Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology9

Leaf length25 mm

Leaf length max40 mm

Leaf length min10 mm

Leaf width3.5 mm

Leaf width max5 mm

Leaf width min2 mm

Plant height0.6 m

Plant height max0.9 m

Plant height min0.3 m

Life cycle & reproduction9

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Pollination syndromeinsect

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio44.31 g/g

Leaf c474 mg/g

Leaf n10.7 mg/g

Leaf p0.51 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)25.83 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chloanthes parviflora has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSGQ381137.1 ↗594 bp

ACGT

CAAAGCAGACCGCGAACACGTGATTAACAACACAGGGCCCGCGGTACGGTGGGAAACCTCCGATCGCGTCGCCAATCCCCGCCGGCGCAC …

Chloanthes parviflora internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type1 109 records

Wild obs. + sensor599

Museum / vouchered472

Cultivated / captive7

Other31

Origin

Native63

Range

Area of Occupancy AOO2 496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 408≤1 km 41≤10 km 28>10 km 21

498 georeferenced · 101 without coordinates

Open the mapobservation + sensor599

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 116≤1 km 58≤10 km 166>10 km 68

408 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence472

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 3

7 georeferenced

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	160
Canberra, AU	82
Mount Annan, AU	62
Museo Entomologico de Leonlocation not on record	48
Armidale, AU	34
Smithfield, AU	20
Adelaide, AU	18
Kew, GB	8
Palmerston, AU	7
James Cook Townsvillelocation not on record	6
NSW Dept of Planning, Industry and Environmentlocation not on record	5
John T. Waterhouse Herbariumlocation not on record	4
Wollongong, AU	3
Parkville, AU	3
Hobart, AU	2
Batemans Bay, AU	2
Auckland, NZ	1

17 institutions · 465 of 472 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Chloanthes parviflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chloanthes parviflora

At a glance

Sources7 archives

Size & morphology9

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Other traits1

At a glance

Record type1 109 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 109 records