Chitalpa tashkentensis

T.S.Elias & Wisura · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Chitalpa

At a glance

Occurrence records32

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Chitalpa tashkentensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF32 records

DNA & barcodingNCBIsequences

01Narrative

× Chitalpa adalah genus hibrida hasil persilangan intergenerik antara Chilopsis linearis dan Catalpa speciosa, Chilopsis linearis dan Catalpa ovata atau Catalpa speciosa. Daunnya berbentuk lanceolat, memiliki panjang 10–13 cm dan lebar 2,5 cm. Bunga spesies ini berbentuk trompet yang panjang dan berumbai—dan memiliki bunga majemuk dengan bentuk yang tidak pasti.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chitalpa tashkentensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

The DNA barcodea real sequence read deposited for this species

ITSDQ515204.1 ↗619 bp

ACGT

TCGAAACCTGCAAAGTAGACCGCGAACACGTTCTCGAATACACGGAGAAACTGACGTGGGGGGTGACCCTTCGTCGTGACCCTTCCCTGC …

X Chitalpa tashkentensis clone 4244c4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type32 records

Wild obs. + sensor1

Museum / vouchered29

Cultivated / captive2

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 7≤1 km 4≤10 km 1

12 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence29

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bangkok, TH	5
ASUlocation not on record	4
Canadian Department of Agriculturelocation not on record	3
Lubbock, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Saint Louis, US	2
Henderson, US	1
Claremont, US	1
Davis, US	1
Riverside, US	1
Provo, US	1
Clemson, US	1
Pullman, US	1
Austin, US	1
València, ES	1
Adam Mickiewicz University in Poznańlocation not on record	1
Fort Worth, US	1

17 institutions · 29 of 29 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)