Chiropetalum canescens — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Chiropetalum

At a glance

Occurrence records22

Data sources4

Biological traits14

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Chiropetalum canescens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF22 records

DNA & barcodingNCBIsequences

01Narrative

Chiropetalum canescens là một loài thực vật có hoa trong họ Đại kích. Loài này được Phil. mô tả khoa học đầu tiên năm 1860.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.2 m

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max200 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · GIFT: woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chiropetalum canescens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ190606.1 ↗593 bpChile · 1987

ACGT

AGAGTGCGGAAGGATCATTGTCAAACCTGCCCAGCAGAACGACCCGCGAACACGTTGCGAAACACAAGGAGGAGCCGGGGCTGCACGGTC …

Chiropetalum canescens isolate y82 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type22 records

Wild obs. + sensor7

Museum / vouchered15

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2≤10 km 1

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	4
Valparaiso, CL	4
UChlocation not on record	3
Edinburgh, GB	3
San Isidro, AR	1

5 institutions · 15 of 15 vouchered records shown