Chironia palustris

Burch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Gentianaceae/Chironia

At a glance

Occurrence records37

Data sources5

Biological traits18

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Chironia palustris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF37 records

DNA & barcodingNCBIsequences

01Narrative

Chironia palustris là một loài thực vật có hoa trong họ Long đởm. Loài này được Burch. mô tả khoa học đầu tiên năm 1824.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.8 m

Plant height max0.69 m

Plant height min0.2 m

Seed mass0.05 mg

Seed mass max0.05 mg

Seed mass min0.05 mg

Life cycle & reproduction3

Life formannual or perennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 903 m

Elevation min15 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition5 compounds

Compounds documented for Chironia palustris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Secoiridoid monoterpenoids5

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Sweroside	present	LOTUS
(3S,4R,4aR)-4a-hydroxy-4-[(2S)-oxiran-2-yl]-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4,5,6-tetrahydropyrano[3,4-c]pyran-8-one	present	LOTUS
Eustomorusside	present	LOTUS
Gentiopicroside	present	LOTUS
Swertiamarin	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chironia palustris has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLFJ014020.1 ↗762 bpSouth Africa

ACGT

GCTAAAATTATCGAATTCAAAAGAAGTATCCCAGAGCACGTCGATCAGTTAATTCAATAAGAAATGGGAGTTAGCAACCCGCTTGGTTGG …

Chironia palustris subsp. transvaalensis atpB-rbcL intergenic spacer, partial sequence; and ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor17

Museum / vouchered20

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 11≤1 km 1≤10 km 1

13 georeferenced · 4 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 4>10 km 3

8 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	13
Saint Louis, US	2
Vancouver, CA	1
Zürich, CH	1
Pretoria, ZA	1

5 institutions · 18 of 20 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)