Chironia baccifera

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Gentianaceae/Chironia

At a glance

Occurrence records3 212

Data sources7

Biological traits17

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Chironia baccifera's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 212 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF3 212 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max1 m

Plant height min0.1 m

Seed mass0.64 mg

Seed mass max0.98 mg

Seed mass min0.29 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 450 m

Elevation min5 m

Epiphyteterrestrial

Growth formherb

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chironia baccifera has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY251720.1 ↗230 bp

ACGT

TCGCGTCGCCCCTAACTCCCCGTGCACCTATTGGTCTGGGCGATAAATGGGGGCGGAGACTGGCCTCCCGTGCCCGTGTGCGGCTGGCCT …

Chironia baccifera internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS6★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type3 212 records

Wild obs. + sensor2 797

Museum / vouchered414

Cultivated / captive1

Range

Area of Occupancy AOO3 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 1 983≤1 km 288≤10 km 64>10 km 17

2 352 georeferenced · 445 without coordinates

Open the mapobservation + sensor2 797

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤1 km 16≤10 km 18>10 km 11

45 georeferenced · 369 without coordinates

Open the institutions mapphysical evidence414

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	217
Cape Town, ZA	75
Durban, ZA	33
Zürich, CH	30
MeiseBGlocation not on record	11
Saint Louis, US	9
MSB-3054location not on record	5
Cape Town, ZA	3
Bronx, US	2
Boise, US	2
GHPG$location not on record	2
Philadelphia, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
GZUlocation not on record	2
University of Johannesburglocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Zürich, CH	1
Wellington, NZ	1
Tampa, US	1
Davis, US	1
GAlocation not on record	1
MAlocation not on record	1
Stockholm, SE	1
Vancouver, CA	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Stellenboschlocation not on record	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1
Fort Worth, US	1
Austin, US	1

29 institutions · 410 of 414 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Chironia baccifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 17.8–17.8

Seasonal swing summer↔winter6.60 °C

Max temp (day)21.2 °C

Min temp (night)14.4 °C

Precipitation50.1 mm/mo

Air humidity59.7 %

Moisture balance-94.4 mm/mo

Vapour deficit816 Pa

Wind speed4.90 m/s

Cloud cover21.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chironia baccifera

At a glance

Sources7 archives

Size & morphology5

Life cycle & reproduction2

Diet & foraging1

Habitat & environment8

Other traits1

At a glance

Record type3 212 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 212 records