Chiloglottis trapeziformis

Fitzg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Chiloglottis

At a glance

Occurrence records834

Data sources8

Biological traits28

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Chiloglottis trapeziformis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility834 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF834 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaTgenome

01Narrative

Chiloglottis trapeziformis, commonly known as the broad-lip bird orchid, diamond ant orchid or dainty bird-orchid, is a species of orchid endemic to south-eastern Australia. It has two narrow leaves and a narrow, greenish to purplish or brownish flower with a short, shiny black, ant-like callus covering the lower quarter of the diamond-shaped labellum. It has been recorded as a vagrant in New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf length65 mm

Leaf width17.5 mm

Plant height0.09 m

Plant height max0.14 m

Plant height min0.08 m

Seed mass0.001 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timennnnnnnyyynn

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_oblong

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chiloglottis trapeziformis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF539937.1 ↗705 bpAustralia

ACGT

ATCATTGTCGAGACCCGAAAGAGACCGAGCAATTTTGACAACACGTGAACTAAATGCAAGACGGTAGCAAAACTTGATGCCGTCGATCAC …

Chiloglottis trapeziformis isolate s0191 18S ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Chiloglottis trapeziformis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type834 records

Wild obs. + sensor539

Museum / vouchered292

Cultivated / captive3

Origin

Native43

Range

Area of Occupancy AOO1 772 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 232≤1 km 123≤10 km 60>10 km 82

497 georeferenced · 42 without coordinates

Open the mapobservation + sensor539

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 33≤1 km 60≤10 km 160>10 km 21

274 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence292

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	129
Museo Entomologico de Leonlocation not on record	79
Mount Annan, AU	36
Hobart, AU	8
Adelaide, AU	8
Smithfield, AU	7
Brisbane, AU	5
Batemans Bay, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Armidale, AU	3
Christchurch, NZ	2
QVMAGlocation not on record	2
Tampa, US	1
Wellington, NZ	1
Wollongong, AU	1
Parkville, AU	1
Palmerston North, NZ	1

17 institutions · 291 of 292 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Chiloglottis trapeziformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)