Chiloglottis sylvestris

D.L.Jones & M.A.Clem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Chiloglottis

At a glance

Occurrence records384

Data sources5

Biological traits21

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Chiloglottis sylvestris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility384 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF384 records

DNA & barcodingNCBIsequences

01Narrative

Chiloglottis sylvestris, commonly known as the small wasp orchid, is a small, delicate species of orchid endemic to eastern Australia. It has two dark green leaves and a single greenish pink flower with a reddish black, insect-like callus surrounded by fine, radiating, red, club-shaped calli on two-thirds of the base of the labellum.Chiloglottis sylvestris habit

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology2

Leaf length45 mm

Leaf width16 mm

Life cycle & reproduction8

Flowering endMay

Flowering startDec

Flowering timeyyyyynnnnnny

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chiloglottis sylvestris has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAY042150.1 ↗731 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGAAAGAGACCGAGCAATTTTGACAACATGTGAACTAAATGCAAGACGGT …

Chiloglottis sylvestris 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type384 records

Wild obs. + sensor104

Museum / vouchered275

Cultivated / captive5

Origin

Native37

Range

Area of Occupancy AOO1 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 41≤1 km 15≤10 km 5>10 km 37

98 georeferenced · 6 without coordinates

Open the mapobservation + sensor104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 28≤1 km 35≤10 km 198>10 km 4

265 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence275

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy80% within 1 km

≤100 m 1≤1 km 3≤10 km 1

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	155
Brisbane, AU	63
Mount Annan, AU	37
Smithfield, AU	8
Armidale, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Batemans Bay, AU	2
Kensington, AU	1
Saint Louis, US	1
Adelaide, AU	1

10 institutions · 275 of 275 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)