Chiloglottis reflexa

(Labill.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Chiloglottis

At a glance

Occurrence records1 191

Data sources7

Biological traits31

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Chiloglottis reflexa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 191 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF1 191 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Chiloglottis reflexa (green form) in cultivation Chiloglottis reflexa, commonly known as the short-clubbed wasp orchid, is a species of orchid endemic to the south-eastern Australia. It has two broad leaves and a single greenish-bronze or purplish flower with an ant-like callus covering most of the top of the labellum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Leaf length35 mm

Leaf size982 mm²

Leaf width12.5 mm

Plant height0.08 m

Plant height max0.1 m

Plant height min0.05 m

Seed mass0.001 mg

Life cycle & reproduction10

Dispersal typewind

Flowering endMay

Flowering startDec

Flowering timeyyyyynnnnnny

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate oblong ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chiloglottis reflexa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF539939.1 ↗699 bpAustralia

ACGT

ATCATTGTCGAGACCCGAAAGAGACCGAGCAATTTTGACAACATGTGAACTAAATGCAAGACGGTAGCAAAACTTGATGCCGTCGATCAC …

Chiloglottis reflexa isolate s1006 18S ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type1 191 records

Wild obs. + sensor591

Museum / vouchered590

Cultivated / captive10

Origin

Native68

Range

Area of Occupancy AOO3 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 342≤1 km 109≤10 km 74>10 km 29

554 georeferenced · 37 without coordinates

Open the mapobservation + sensor591

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 12≤1 km 193≤10 km 286>10 km 59

550 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence590

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 1≤10 km 1>10 km 3

6 georeferenced · 4 without coordinates

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	293
Museo Entomologico de Leonlocation not on record	117
Mount Annan, AU	68
Hobart, AU	45
Adelaide, AU	25
QVMAGlocation not on record	12
Smithfield, AU	9
Brisbane, AU	7
Parkville, AU	4
Kensington, AU	3
Tampa, US	2
Wollongong, AU	1
Armidale, AU	1
La Trobe Universitylocation not on record	1
Batemans Bay, AU	1

15 institutions · 589 of 590 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Chiloglottis reflexa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chiloglottis reflexa

At a glance

Sources7 archives

Size & morphology7

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 191 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 191 records