Chiloglottis gunnii

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Chiloglottis

At a glance

Occurrence records571

Data sources5

Biological traits23

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Chiloglottis gunnii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility571 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF571 records

DNA & barcodingNCBIsequences

01Narrative

Chiloglottis gunnii, commonly known as the tall bird orchid, is a species of orchid endemic to Tasmania. It has two broad leaves and a single green to purplish brown flower with a line of erect calli with swollen heads along the mid-line of the labellum. It is widespread but mainly in coastal districts and most commonly in moist to wet forest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Leaf length50 mm

Leaf size982 mm²

Leaf width17.5 mm

Plant height0.1 m

Life cycle & reproduction8

Dispersal typewind

Flowering timeyynnnnnnnnny

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chiloglottis gunnii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF539930.1 ↗702 bpAustralia

ACGT

ATCATTGTCGAGACCCGAAAGAGACCGAGCAATTTTGACAACATGTGAACTAAATGCAAGACGGTAGCAAAATTTGATGCCGTCGATCAC …

Chiloglottis gunnii isolate MAC008 18S ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type571 records

Wild obs. + sensor349

Museum / vouchered216

Cultivated / captive6

Origin

Native16

Introduced1

Range

Area of Occupancy AOO1 348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 174≤1 km 109≤10 km 26>10 km 8

317 georeferenced · 32 without coordinates

Open the mapobservation + sensor349

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 10≤1 km 59≤10 km 78>10 km 25

172 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence216

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 4

6 georeferenced

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	83
Hobart, AU	36
QVMAGlocation not on record	28
Museo Entomologico de Leonlocation not on record	23
Mount Annan, AU	16
Adelaide, AU	15
Brisbane, AU	8
Christchurch, NZ	3
Vancouver, CA	1
Tampa, US	1
Armidale, AU	1
Smithfield, AU	1

12 institutions · 216 of 216 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)