Chiloglottis cornuta

Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Chiloglottis

At a glance

Occurrence records3 559

Data sources7

Biological traits37

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Chiloglottis cornuta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 559 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF3 559 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 40

01Narrative

Side view showing characteristic flattened glands on labellum. Chiloglottis cornuta, commonly known as the green bird orchid, is a species of orchid found in south-eastern Australia and in New Zealand, including many of its offshore islands. It has two broad leaves and a single green or pinkish flower with six to eight rounded, flattened green, reddish or blackish calli on the labellum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology9

Leaf length70 mm

Leaf length max100 mm

Leaf size2 199 mm²

Leaf width25 mm

⚠ sources differ — AusTraits: 25 mm · GIFT: 30 mm

Leaf width max30 mm

Leaf width min30 mm

Plant height0.07 m

⚠ sources differ — GIFT: 0.07 m · AusTraits: 0.04 m

Plant height max0.1 m

Plant height min0.02 m

Life cycle & reproduction13

Deciduousnessdeciduous

Dispersal typewind

Flowering endJan

Flowering startDec

Flowering timeynnnnnnnnnny

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualpresent

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_oblong

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chiloglottis cornuta has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKF539929.1 ↗702 bpAustralia

ACGT

ATCATTGTCGAGACCCGAAAGAGACCGAGCAATTTTGACAACATGTGAACTAAATGCAAGACGGTAGCAAAATTTGATGCCGTCGATCAC …

Chiloglottis cornuta isolate MAC007 18S ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Chiloglottis cornuta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · new-zealand

CCDB · new-zealand

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 559 records

Wild obs. + sensor2 862

Museum / vouchered693

Cultivated / captive4

Origin

Native28

Range

Area of Occupancy AOO8 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 615≤1 km 498≤10 km 249>10 km 145

2 507 georeferenced · 355 without coordinates

Open the mapobservation + sensor2 862

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 16≤1 km 83≤10 km 158>10 km 19

276 georeferenced · 417 without coordinates

Open the institutions mapphysical evidence693

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 3

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	227
Canberra, AU	111
Wellington, NZ	101
Museo Entomologico de Leonlocation not on record	72
Auckland, NZ	51
Hobart, AU	40
Adelaide, AU	26
Rotorua, NZ	22
Mount Annan, AU	15
QVMAGlocation not on record	12
Smithfield, AU	6
Tampa, US	2
South Kensington, GB	2
Parkville, AU	1
Brisbane, AU	1
Wollongong, AU	1
Chicago, US	1

17 institutions · 691 of 693 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chiloglottis cornuta

At a glance

Sources7 archives

Size & morphology9

Life cycle & reproduction13

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 559 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 17 geolocated

Cultivated / Captivenot free-living

Record type3 559 records