Chiloglanis bifurcus

Jubb & Le Roux, 1969 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Mochokidae/Chiloglanis

At a glance

Occurrence records87

Data sources9

Biological traits5

DNA specimens3

eDNA detections6

Sources9 archives

Databases and archives Chiloglanis bifurcus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility87 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF87 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD3 specimens

01Narrative

The Incomati rock catlet or Incomati suckermouth (Chiloglanis bifurcus) is a species of upside-down catfish native to Mozambique, South Africa and Swaziland where it is only found in the Crocodile-Incomati River system. This species grows to a length of 6.8 cm SL.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6.8 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chiloglanis bifurcus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)3.2%

Haplotypes1

BIN1

Where individuals differ — all 22 variable positions, in barcode order

1Gvariable

3Avariable

5Gvariable

6Gvariable

7Gvariable

9Cvariable

10Gvariable

11Cvariable

12Gvariable

13Avariable

14Avariable

15Cvariable

17Cvariable

20Avariable

21Avariable

22Avariable

23Avariable

24Gvariable

386Cvariable

415Gvariable

609Gvariable

610Avariable

GTATGGGGCGCGAACCCGGAAAAGTGGCACAGCCCTTAGCCTGCTCATTCGAGCAGAACTAGCCCAACCTGGCACTCTTCTAGGCGACGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chiloglanis anoterussame genus3.1%Chiloglanis pretoriaesame genus4.8%Chiloglanis fasciatussame genus8.1%Chiloglanis brevibarbissame genus9.4%Chiloglanis lamotteisame genus12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type87 records

Wild obs. + sensor6

Museum / vouchered36

Other45

Origin

Native36

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 1>10 km 2

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 36 records without

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	36

1 institutions · 36 of 36 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Chiloglanis bifurcus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–18.8

Seasonal swing summer↔winter15.6 °C

Max temp (day)26.6 °C

Min temp (night)11.7 °C

Precipitation34.5 mm/mo

Air humidity48.3 %

Moisture balance-98.6 mm/mo

Vapour deficit1,186 Pa

Wind speed2.90 m/s

Cloud cover16.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)