Chiliadenus iphionoides

(Boiss. & C.I.Blanche) Brullo · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Chiliadenus

At a glance

Occurrence records3 145

Data sources8

Biological traits10

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Chiliadenus iphionoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 145 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF3 145 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

كتيلة زفرية هي نوع من النباتات تتبع جنس الكتيلة من الفصيلة النجمية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.537 mg

Seed mass max0.52 mg

Seed mass min0.52 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition14 compounds

Compounds documented for Chiliadenus iphionoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavonols20

Flavones3

Eudesmane sesquiterpenoids2

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
3,3'-di-O-methylquercetin	present	LOTUS
3,4',5,6,7-Pentamethoxyflavone	present	LOTUS
3-Methoxytangeretin	present	LOTUS
3-O-Methylkaempferol	present	LOTUS
4'-Hydroxytetramethoxyflavone	present	LOTUS
6-Hydroxykaempferol 3,6-dimethylether	present	LOTUS
Apigenin	present	NPASS
Chrysoeriol	present	NPASS
Jaceidin	present	LOTUS
Jaranol	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chiliadenus iphionoides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences5

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMG543263.1 ↗343 bp

ACGT

AGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCTATAAAGCAGAACGACCCGTGAACATGTAACGAC …

Chiliadenus iphionoides voucher Blanche s.n. 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type3 145 records

Wild obs. + sensor3 130

Museum / vouchered15

Range

Area of Occupancy AOO5 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 221≤1 km 31≤10 km 342>10 km 1

595 georeferenced · 2 535 without coordinates

Open the mapobservation + sensor3 130

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rishon Le Zion, IL	7
Wlocation not on record	3
CJBGlocation not on record	1
Barcelona, ES	1
Moscow State Universitylocation not on record	1
Frankfurt am Main	1
Karlsruhe, DE	1

7 institutions · 15 of 15 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Chiliadenus iphionoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chiliadenus iphionoides

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction1

Diet & foraging1

Habitat & environment4

Physiology & chemistry1

Compound class profile3 classes

Documented compounds14 total

At a glance

Record type3 145 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 145 records