Chiasmia aestimaria

(Hübner, 1809) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Chiasmia

At a glance

Occurrence records1 526

Data sources7

Biological traits2

DNA specimens92

eDNA detections98

Sources7 archives

Databases and archives Chiasmia aestimaria's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 526 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI98 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics92 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 526 records

Environmental DNA1 datasets · 22 countries98 detections

DNA & barcodingBOLD92 specimens

01Narrative

Godonela aestimaria, the tamarisk peacock, is a moth of the family Geometridae. It is found in southern and south-eastern Europe and the Middle East. The wingspan is 21–25 mm. There are two generations per year with adults on wing from April to May and again from August to October. The larvae feed on various species of Tamarix.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding92 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chiasmia aestimaria has left across the world's sequence archives.

At a glance

DNA specimens92

BINs4

Marker genes2

eDNA detections98

Countries24

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus75 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 56 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

40Tvariable

41Gmostly conserved

49Tmostly conserved

50Cmostly conserved

91Cmostly conserved

100Amostly conserved

118Cvariable

133Tmostly conserved

166Amostly conserved

206Tvariable

211Avariable

217Amostly conserved

263Cvariable

268Tvariable

271Tvariable

316Avariable

328Avariable

367Tvariable

391Tvariable

403Amostly conserved

433Amostly conserved

457Tvariable

493Amostly conserved

506Gvariable

556Avariable

581Tvariable

610Cmostly conserved

616Tmostly conserved

628Avariable

634Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTCTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes21

BINs3

Most divergent pair3.6%

EuropeAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chiasmia syriacariasame genus4.9%Chiasmia streniatasame genus5.8%Chiasmia hebesatasame genus6.5%Chiasmia buettikerisame genus6.5%Melanolophia canadariasame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 526 records

Wild obs. + sensor1 411

Museum / vouchered114

Other1

Origin

Native5

Introduced12

Range

Area of Occupancy AOO2 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 442≤1 km 142≤10 km 272>10 km 92

948 georeferenced · 463 without coordinates

Open the mapobservation + sensor1 411

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 8≤1 km 26≤10 km 10>10 km 2

46 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	33
ZSMlocation not on record	21
Washington, US	8
Bavarian State Collection of Zoologylocation not on record	6
Zürich, CH	5
Salzburg, AT	4
Natural History Museum Rotterdamlocation not on record	4
Geneva, CH	2
Tallinn, EE	1
Research Collection of Gergely Petranyilocation not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1

11 institutions · 86 of 114 vouchered records shown · 27 without an institution code

09Environmental DNA98 detections

Where the DNA of Chiasmia aestimaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found98

Studies independent surveys1

Countries22

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 98 detections have coordinates

Open the map22 countries0

8. Desert | 8.1. Hot Desertforest edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 12.2–27.7

Seasonal swing summer↔winter20.8 °C

Max temp (day)25.2 °C 17.5–33.5

Min temp (night)16.5 °C 7.00–22.1

Precipitation26.3 mm/mo 3.80–81.1

Air humidity53.0 % 45.0–60.1

Moisture balance-82.4 mm/mo -162–-2.40

Vapour deficit1,066 Pa 696–1,944

Wind speed2.60 m/s 1.70–3.90

Cloud cover34.9 % 13.3–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 86 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chiasmia aestimaria

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 526 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 526 records