Cherleria obtusiloba

(Rydb.) A.J.Moore & Dillenb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Cherleria

At a glance

Occurrence records1 836

Data sources9

Biological traits13

DNA specimens0

eDNA detections13

Sources9 archives

Databases and archives Cherleria obtusiloba's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 836 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF1 836 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Minuartia obtusiloba is a perennial alpine herb known by the common names alpine sandwort and twinflower stitchwort. It is native to the mountains of western North America from the High Sierra of California to the Colorado Rockies north to Alaska. Its range may extend into far eastern Russia. This is a low plant forming mats or clumps and bearing small thimble-shaped flowers with curving white petals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Leaf size2.8 mm²

Plant height0.015 m

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatesubalpine or subarctic

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessnon-woody

Physiology & chemistry5

Leaf C:N ratio21.36 g/g

Leaf c443 mg/g

Leaf dry-matter content (LDMC)200 mg/g

Leaf n20.8 mg/g

Specific leaf area (SLA)24.92 mm²/mg

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cherleria obtusiloba has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections13

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG235138.1 ↗434 bpCanada · 2000

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTNTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG …

Cherleria obtusiloba voucher CCDB-18328-D1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cherleria obtusiloba carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidypolyploid inferred

Chromosome records26–262n range26median26mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 268×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.

CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1980. Chromosome numbers and taxonomy of some species of the Anyui Mts. Bot. Zhurn. 65 (5): 651–659.

CCDB · ipcn-api-dl — Love, A. & D. Love. 1975b. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.

CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1975. Chromosome numbers of some Western Chukolka plant species. Bot. Žhurn. (Moscow & Leningrad) 60(3): 395–401.

CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.

CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976

CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1975

CCDB · book-ipcn75-78 — Love & Love 1975b

n 131×CCDB · Cave1962

CCDB · Cave1962 — Wiens & H. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.980 ↗

08Occurrence & distribution

Record type1 836 records

Wild obs. + sensor1 454

Museum / vouchered382

Range

Area of Occupancy AOO3 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 779≤1 km 133≤10 km 72>10 km 30

1 014 georeferenced · 440 without coordinates

Open the mapobservation + sensor1 454

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 82≤1 km 73≤10 km 61>10 km 7

223 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence382

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	77
Tempe, US	35
Albuquerque, US	32
Pullman, US	30
WTUlocation not on record	28
Wuzhou, CN	27
Provo, US	27
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	20
Corvallis, US	17
Caldwell, US	11
Claremont, US	9
Moscow, US	7
DOI/NPS, Mount Rainier National Parklocation not on record	7
University of Alberta Museumslocation not on record	6
Whitehorse, CA	6
Dekalb, US	5
University of Stellenboschlocation not on record	5
Pittsburg, US	4
Logan, US	3
Durango, US	3
Moscow State Universitylocation not on record	2
Boise, US	2
Olocation not on record	2
CASlocation not on record	2
DOI/NPS, Colonial National Historical Parklocation not on record	1
ASUlocation not on record	1
Institute of the biological problems of the North FEB RASlocation not on record	1
Pocatello, US	1

28 institutions · 371 of 382 vouchered records shown · 11 without an institution code

09Environmental DNA13 detections

Where the DNA of Cherleria obtusiloba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Dry slopeAlpine turf

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C 7.20–13.4

Seasonal swing summer↔winter29.5 °C

Max temp (day)15.3 °C 12.3–18.6

Min temp (night)4.80 °C 2.10–7.80

Precipitation62.4 mm/mo 50.4–87.0

Air humidity56.0 % 48.5–62.8

Moisture balance-49.7 mm/mo -80.2–7.10

Vapour deficit538 Pa 402–745

Wind speed3.80 m/s 2.80–5.20

Cloud cover44.3 % 27.4–67.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cherleria obtusiloba

At a glance

Sources9 archives

Size & morphology2

Life cycle & reproduction2

Habitat & environment4

Physiology & chemistry5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 836 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 836 records