Cherleria marcescens

(Fernald) A.J.Moore & Dillenb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Cherleria

At a glance

Occurrence records69

Data sources6

Biological traits9

DNA specimens0

eDNA detections20

Sources6 archives

Databases and archives Cherleria marcescens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF69 records

Environmental DNA2 datasets · 2 countries20 detections

DNA & barcodingNCBIsequences

01Narrative

Minuartia marcescens là loài thực vật có hoa thuộc họ Cẩm chướng. Loài này được (Fernald) House mô tả khoa học đầu tiên năm 1921.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cherleria marcescens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

eDNA detections20

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG236884.1 ↗329 bpCanada

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG …

Cherleria marcescens voucher CCDB-24896-G05 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor47

Museum / vouchered22

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 10≤1 km 3>10 km 24

37 georeferenced · 10 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 15

15 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Montréal, CA	19
Provo, US	1
Moscow State Universitylocation not on record	1

3 institutions · 21 of 22 vouchered records shown · 1 without an institution code

09Environmental DNA20 detections

Where the DNA of Cherleria marcescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

peridotite plateau w of gully between gabbro…Exposed peridotite barren knob, with blocks …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.50 °C 4.10–4.50

Seasonal swing summer↔winter29.0 °C

Max temp (day)5.60 °C 5.40–5.60

Min temp (night)3.10 °C 2.20–3.10

Precipitation48.0 mm/mo 48.0–49.3

Air humidity63.2 % 63.2–64.0

Moisture balance2.90 mm/mo 2.90–3.10

Vapour deficit309 Pa 295–309

Wind speed4.60 m/s 4.50–4.60

Cloud cover62.4 % 62.3–62.4

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)