Chenopodium vulvaria
speciesAt a glance
Occurrence records12 364
Data sources15
Biological traits61
DNA specimens11
eDNA detections10
Sources15 archives
Databases and archives Chenopodium vulvaria's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 364 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources61 traits
Chemical compositionLOTUS · NPASS8 compounds
Occurrence & distributionGBIF12 364 records
Environmental DNA1 datasets · 2 countries10 detections
DNA & barcodingBOLD · NCBI11 specimens
Genome at a glanceCCDB · GoaT · NCBI446 Mbp
01Narrative
Chenopodium vulvaria, the stinking goosefoot or notchweed, is a foul-smelling plant or weed. The plant is a member of the genus Chenopodium, the goosefoots.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology21
Leaf length15 mm
Leaf length max40 mm
Leaf length min10 mm
Leaf size1 125 mm²
Leaf width10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 15 mm
Leaf width max15 mm
Leaf width min10 mm
Plant height0.225 m
⚠ sources differ — GIFT: 0.225 m · LEDA: 0.275 m · TRY: 0.17 m
Plant height generative0.275 m
Plant height max0.6 m
Plant height min0.01 m
Seed length1.28 mm
Seed mass0.465 mg
⚠ sources differ — TRY: 0.465 mg · LEDA: 0.496 mg · GIFT: 0.408 mg
Seed mass max0.56 mg
Seed mass min0.045 mg
Seed volume0.52 mm³
Seed volume max0.52 mm³
Seed volume min0.52 mm³
Seed width1.25 mm
⚠ sources differ — AusTraits: 1.25 mm · GIFT: 1 mm
Seed width max1.25 mm
Seed width min1 mm
Life cycle & reproduction14
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typehuman
Flowering endSep
Flowering startJul
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Self fertilizationabsent
Sex typemonoecious
⚠ sources differ — AusTraits: monoecious · GIFT: bisexual
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 770 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nutlet · GIFT: achene
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formovate
Leaf shapeovate trullate widely_ovate
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio9.44 g/g
Leaf c338 mg/g
Leaf dry-matter content (LDMC)112 mg/g
Leaf n32.93 mg/g
Leaf p5.11 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)34.75 mm²/mg
Other traits3
Diaspore typegenerative dispersule
Inflorescencepanicle
Leaf arrangementalternate
03Chemical composition8 compounds
Compounds documented for Chenopodium vulvaria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cinnamic acids and derivatives2
Eudesmane sesquiterpenoids1
Kaurane and Phyllocladane diterpenoids1
Kaurane and Phyllocladane diterpenoids $ Norkaurane diterpenoids $ Tetracyclic diterpenoids1
Flavones1
Documented compounds8 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (S)-Rosmarinic acid | present | NPASS | |
| 2-(3,4-Dihydroxyphenyl)-5,6-dihydroxy-7-methoxy-4H-1-benzopyran-4-one | present | NPASS | |
| Cryptomeridiol | present | LOTUS | |
| Kamebakaurin | present | NPASS | |
| Methyl Rosmarinate | present | NPASS | |
| OHCSQGHHDTUPPF-OETGUIPGSA-N | present | NPASS | |
| Rabdoserrin B | present | NPASS | |
| WHSUEVLJUHPROF-IMZDMEOWSA-N | present | NPASS |
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chenopodium vulvaria has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes4
GenBank sequences10
eDNA detections10
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGTCGAGGGCACGCCTGCCTGGGCGTCACGCATC …
Chenopodium vulvaria voucher CCDB-24918-E03 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Chenopodium vulvaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size446 212 500 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Chenopodium vulvaria0.45 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–722n range18median18mode36records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1833×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Schwarzová T., 1980: [Report], pp. 728. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. X. Chenopodiaceae. Queirs, M.Bol. Soc. Brot. ser. 249: 121-142(1975).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 551-555. Granado, C., T. Luque & J. Pastor.Lagascalia15(1): 133-136(1988).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1805
CCDB · fl-europaea — Lb'vkvist, 1963
CCDB · mediterranean
CCDB · ipcn-api-dl — Granado, C., T. Luque & J. Pastor. 1988. Números cromosómicos para la flora Española. 551--555. Lagascalia 15: 133–136.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Lomonosova, M. N. & A. A. Krasnikov. 1994. Chromosome numbers in some species of genus Chenopodium (Chenopodiaceae) of the flora of Siberia. Bot. Žhurn. (Moscow & Leningrad) 79(3): 124–125.
CCDB · ipcn-api-dl — Runemark, H. 1996. Mediterranean chromosome number reports 6 (590--678). Fl. Medit. 6: 223–243.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — SCHWARZOVA, T. 1980. In Chromosome number reports LXIX. Taxon 29:728.
CCDB · ipcn-api-dl — Queiros, M. 1975. Contribuicao para o conhecimento citotaxonomico das Spermatophyta de Portugal. X. Chenopodiaceae. Bol. Soc. Brot., sér. 2 49: 121–142.
CCDB · ipcn-api-dl — Lomonosova, M. N., S. A. Krasnikova, A. A. Krasnikov, A. L. Ebel & N. A. Rudaja. 2003. Chromosome numbers of the family members Chenopodiaceae representatives from Mongolia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 88(8): 113–115.
CCDB · book-ipcn75-78 — Queiros 1975
CCDB · eflora
CCDB · book-fedorov — Winge 1917a, b
CCDB · book-fedorov — Kawatani, Ohno 1956
CCDB · Cave1956 — Kawatani & Ohno
CCDB · CromoCat 2015 — Dvorák, F. (1989). Chromosome counts and chromosome morphology of some selected species. Scripta Facultatis Scientiarum Naturalium Universitatis Purkynianae Brunensis 19: 301-322.
CCDB · CromoCat 2015 — Granado, C., Luque, T. & Pastor, J. (1988). Números cromosómicos para la flora española, 551-555. Lagascalia 15(1): 133-136.
CCDB · CromoCat 2015 — Kawatani, T. & Ohno, T. (1956). Chromosome numbers of genus Chenopodium. II. Jap. J. Genet. 31: 15-17.
CCDB · CromoCat 2015 — Queirós, M. (1975a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. X. Chenopodiaceae. Bol. Soc. Brot. 49: 121-142.
CCDB · CromoCat 2015 — Runemark, H. (1996). Mediterranean chromosome number reports-6 Fl. Medit. 6: 223-243.
CCDB · CromoCat 2015 — Schwarzová, T. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 728.
CCDB · CromoCat 2015 — Winge, Ö. (1917). The chromosomes. Their numbers and general importance. Compt. Rend. Trav. Carlsberg Lab., Sér. Physiol. 13: 131-275.
2n 362×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Dvorák, F. (1989). Chromosome counts and chromosome morphology of some selected species. Scripta Facultatis Scientiarum Naturalium Universitatis Purkynianae Brunensis 19: 301-322.
CCDB · CromoCat 2015 — Queirós, M. (1975a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. X. Chenopodiaceae. Bol. Soc. Brot. 49: 121-142.
2n 721×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Queirós, M. (1975a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. X. Chenopodiaceae. Bol. Soc. Brot. 49: 121-142.
n 181×CCDB · Cave1956supp
CCDB · Cave1956supp — Quhel 1955
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type12 364 records
Wild obs. + sensor9 944
Museum / vouchered2 267
Cultivated / captive2
Fossil1
Other150
Origin
Native339
Introduced282
Range
Area of Occupancy AOO27 716 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy29% within 1 km
≤100 m 1 461≤1 km 757≤10 km 5 235>10 km 200
7 653 georeferenced · 2 291 without coordinates
Open the mapobservation + sensor9 944
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 45≤1 km 364≤10 km 501>10 km 114
1 024 georeferenced · 1 243 without coordinates
Open the institutions mapphysical evidence2 267
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 1
2 georeferenced
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions76 of 149 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 190 |
| Berlin, DE | 173 |
| MeiseBGlocation not on record | 142 |
| BRNUlocation not on record | 124 |
| BFLlocation not on record | 118 |
| Uppsala, SE | 98 |
| BIO-UNIPIlocation not on record | 98 |
| Bern, CH | 63 |
| MAlocation not on record | 50 |
| Brussel, BE | 40 |
| GJOlocation not on record | 38 |
| Zürich, CH | 37 |
| València, ES | 37 |
| Moscow State Universitylocation not on record | 35 |
| Museo Entomologico de Leonlocation not on record | 33 |
| Adam Mickiewicz University in Poznańlocation not on record | 32 |
| Zürich, CH | 32 |
| Oskarshamn, SE | 25 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 25 |
| College of the Atlantic, Museumlocation not on record | 22 |
| Wlocation not on record | 22 |
| Barcelona, ES | 21 |
| Vitoria, ES | 19 |
| Olocation not on record | 19 |
| BDBClocation not on record | 18 |
| South Kensington, GB | 17 |
| Jaén, ES | 16 |
| Canadian Department of Agriculturelocation not on record | 15 |
| Mlocation not on record | 15 |
| SLU Artdatabankenlocation not on record | 13 |
| Bergen, NO | 13 |
| Görlitz, DE | 13 |
| Mount Annan, AU | 13 |
| San Sebastián, ES | 12 |
| Helsinki, FI | 12 |
| Pamplona, ES | 10 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 10 |
| Philadelphia, US | 10 |
| Frankfurt am Main | 10 |
| Davis, US | 10 |
| PRClocation not on record | 9 |
| Salzburg, AT | 9 |
| GMBAlocation not on record | 8 |
| CJBGlocation not on record | 8 |
| BClocation not on record | 8 |
| Granada, ES | 8 |
| Madrid, ES | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 7 |
| Alicante, ES | 7 |
| Hobart, AU | 6 |
| Phyletisches Museum Jenalocation not on record | 6 |
| GZUlocation not on record | 6 |
| Provincia di Livornolocation not on record | 6 |
| Chicago, US | 6 |
| Salamanca, ES | 6 |
| Rishon Le Zion, IL | 6 |
| CICYTEXlocation not on record | 6 |
| Uniwersytet Wrocławskilocation not on record | 6 |
| Badajoz, ES | 6 |
| Canberra, AU | 6 |
| Adelaide, AU | 6 |
| ISAlocation not on record | 6 |
| Córdoba, ES | 5 |
| John May Museum of Natural Historylocation not on record | 5 |
| Claremont, US | 5 |
| Entomological Society of Latvialocation not on record | 5 |
| UIBlocation not on record | 5 |
| Trondheim, NO | 5 |
| Christchurch, NZ | 5 |
| Riverside, US | 5 |
| Paris, FR | 4 |
| Regensburgische Botanische Gesellschaftlocation not on record | 4 |
| JBSlocation not on record | 4 |
| Uniwersytet Jagiellońskilocation not on record | 4 |
| Pamplona, ES | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Madison, US | 3 |
| Frauenfeld, CH | 3 |
| Bloomington, US | 3 |
| Bourges, FR | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Philadelphia, US | 3 |
| Oregon State Universitylocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| UGentlocation not on record | 3 |
| San Luis Obispo, US | 2 |
| EEZA-CSIClocation not on record | 2 |
| ER Hellerlocation not on record | 2 |
| Pullman, US | 2 |
| Santa Barbara, US | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Corvallis, US | 2 |
| Porrentruy, CH | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Sevilla, ES | 2 |
| Brisbane, AU | 2 |
| New Brunswick, US | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Podgorica, ME | 1 |
| KMNlocation not on record | 1 |
| Institute for Biology of National Academy of Sci.location not on record | 1 |
| 16320location not on record | 1 |
| Coimbra, PT | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Tilburg, NL | 1 |
| Staten Island, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| STUlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Göteborg, SE | 1 |
| H-AkrKGlocation not on record | 1 |
| Xiamen, CN | 1 |
| WTUlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| BMlocation not on record | 1 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 1 |
| Bratislava, SK | 1 |
| UBT-Kaullocation not on record | 1 |
| Saint Louis, US | 1 |
| Salvador, BR | 1 |
| No collectionlocation not on record | 1 |
| Henderson, US | 1 |
| LfUlocation not on record | 1 |
| NMWlocation not on record | 1 |
| TROMlocation not on record | 1 |
| Irvine, US | 1 |
| Paleontological Collectionlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Québec, CA | 1 |
| Ann Arbor, US | 1 |
| Bronx, US | 1 |
| CASlocation not on record | 1 |
| Smithfield, AU | 1 |
| Nijmegen, NL | 1 |
| Auckland, NZ | 1 |
| San Jose, US | 1 |
| H-Meierottlocation not on record | 1 |
| Castelar, AR | 1 |
| Taipei, TW | 1 |
| Davenport, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Dresden, DE | 1 |
| Turku, FI | 1 |
| Chongqing Museumlocation not on record | 1 |
| University of Birminghamlocation not on record | 1 |
| Museum Wasmannlocation not on record | 1 |
149 institutions · 2 021 of 2 267 vouchered records shown · 243 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Chenopodium vulvaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map2 countries0
about cities, local
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.9 °C 14.5–15.2
Seasonal swing summer↔winter11.5 °C
Max temp (day)17.7 °C 17.2–19.5
Min temp (night)11.5 °C 9.80–11.6
Precipitation76.1 mm/mo 41.9–98.5
Air humidity61.5 % 55.2–63.0
Moisture balance-24.2 mm/mo -60.0–13.9
Vapour deficit650 Pa 612–869
Wind speed4.30 m/s 2.70–4.40
Cloud cover47.5 % 40.9–50.8
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.