Chenopodium robertianum

Iamonico & Mosyakin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Chenopodium

At a glance

Occurrence records656

Data sources6

Biological traits31

DNA specimens0

eDNA detections1

Sources6 archives

Databases and archives Chenopodium robertianum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility656 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF656 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Chenopodium robertianum (Syn. Einadia hastata, Rhagodia hastata), known by the common name of saloop or berry saltbush is a small plant in the family Amaranthaceae. This species is found in coastal and inland areas of eastern Australia. Occasionally seen in rainforest gullies, though mostly seen in more open areas. Often found in the heavier soils, up to 50 cm tall. Leaves may be opposite or alternate on the stem. Triangular to broadly triangular in shape. Tiny green flowers form in summer.Les Robinson - Field Guide to the Native Plants of Sydney, page 153

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology11

Fruit length2.5 mm

Fruit width2.5 mm

Leaf length15 mm

Leaf length max40 mm

Leaf mass per area72.16 g/m2

Leaf size168 mm²

Leaf width10 mm

Plant height0.5 m

⚠ sources differ — GIFT: 0.5 m · AusTraits: 0.2 m

Seed length1.5 mm

Seed mass0.635 mg

Seed width1.5 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timeyyynnnnnnnyy

Life formperennial or subshrub

Life spanperennial

Pollination syndromeabiotic

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: herb

Leaf compoundnesssimple

Leaf shapetriangular

Woodinessnon-woody

⚠ sources differ — AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chenopodium robertianum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896088.1 ↗553 bpAustralia · 2012

ACGT

AAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAAACCCTAGATACTGATATCTTGGCAGC …

Einadia hastata voucher 129308291 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type656 records

Wild obs. + sensor655

Museum / vouchered1

Range

Area of Occupancy AOO1 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 370≤1 km 90≤10 km 20>10 km 26

506 georeferenced · 149 without coordinates

Open the mapobservation + sensor655

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA1 detections

Where the DNA of Chenopodium robertianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 12.2–12.2

Seasonal swing summer↔winter15.3 °C

Max temp (day)18.0 °C

Min temp (night)7.60 °C

Precipitation37.5 mm/mo

Air humidity56.6 %

Moisture balance-34.5 mm/mo

Vapour deficit619 Pa

Wind speed3.80 m/s

Cloud cover22.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)