Chenopodium pallidicaule

Aellen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Chenopodium

At a glance

Occurrence records55

Data sources12

Biological traits17

DNA specimens4

eDNA detections4

Sources12 archives

Databases and archives Chenopodium pallidicaule's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility55 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources17 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF55 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT · NCBI489 Mbp

01Narrative

Chenopodium pallidicaule, known as cañihua, canihua or cañahua (from Quechua qañiwa, qañawa or qañawi)Teofilo Laime Ajacopa, Diccionario Bilingüe Iskay simipi yuyayk'ancha, La Paz, 2007 (Quechua-Spanish dictionary)Diccionario Quechua - Español - Quechua, Academía Mayor de la Lengua Quechua, Gobierno Regional Cusco, Cusco 2005 (Quechua-Spanish dictionary) and also kaniwa, is a species of goosefoot, similar in character and uses to the closely related quinoa (Chenopodium quinoa). Cañihua is native to the Andean region, with more than 200 varieties, and it has been farmed in the Altiplano for millennia. As a crop, cañihua has distinct characteristics, including tolerance of high mountain conditions, high content of protein and dietary fiber, and rich phenolic content.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height0.6 m

Life cycle & reproduction6

Life formannual

Life spanannual

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formtherophyte

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max4 500 m

Elevation min4 000 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition8 compounds

Compounds documented for Chenopodium pallidicaule across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile2 classes

Flavonols7

Ecdysteroids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-3-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-3-[(2S,3S,4R,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-6-[[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-5,7-dihydroxychromen-4-one	present	LOTUS
20-Hydroxyecdysone	present	LOTUS
3-[(2R,3S,4R,5S,6S)-3-[(2S,3S,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-4,5-dihydroxy-6-[[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromen-4-one	present	LOTUS
3-[(2S,3R,4S,5S,6S)-4,5-dihydroxy-3-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-6-[[(2R,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)chromen-4-one	present	LOTUS
3-[(2S,3S,4R,5R,6R)-3-[(2S,3S,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-4,5-dihydroxy-6-[[(2R,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromen-4-one	present	LOTUS
Kaempferol 3-robinobioside	present	LOTUS
Quercetin 3-robinobioside	present	LOTUS
Quercetin 3-rutinoside	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chenopodium pallidicaule has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ629055.1 ↗566 bp

ACGT

GCAGAGCGACCAGAGAACAAGTTTATCATGAACGGGGATGTGGCGAAAGCCCCTTCCCCAAGCTGGGGAGCTGCTCCGCCTTGGTGGGGT …

Chenopodium pallidicaule voucher KTU139117 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Chenopodium pallidicaule carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size489 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Chenopodium pallidicaule0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71 · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn67-71 — GIUSTI, L. 1970. El genera Chenopodium en Argentina I. Numeros de cromosomas. Darwiniana 16: 98-105.

CCDB · kew — Bennett MD, Smith JB. 1991. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 334: 309-345.

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gandarillas, H. & J. Gutiérrez. 1972. Poliploidia inducida en cañahua (Chenopodium pallidicaule Aellen) con colchicina. Bol. Genet. 8: 11–15.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.9% BUSCO

08Occurrence & distribution

Record type55 records

Wild obs. + sensor4

Museum / vouchered17

Cultivated / captive1

Other33

Origin

Native6

Introduced1

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence17

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Córdoba, AR	6
Saint Louis, US	3
La Paz, BO	3
Berlin, DE	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Kew, GB	1
San Isidro, AR	1

7 institutions · 16 of 17 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Chenopodium pallidicaule was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.3–25.6

Seasonal swing summer↔winter3.30 °C

Max temp (day)28.4 °C 27.9–28.9

Min temp (night)21.5 °C 20.8–22.3

Precipitation157 mm/mo 146–168

Air humidity66.7 % 65.3–68.1

Moisture balance33.9 mm/mo 21.1–46.7

Vapour deficit1,046 Pa 1,044–1,049

Wind speed1.10 m/s 0.9–1.20

Cloud cover53.3 % 49.6–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)