Chenopodium hians

Standl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Chenopodium

At a glance

Occurrence records173

Data sources12

Biological traits10

DNA specimens11

eDNA detections7

Sources12 archives

Databases and archives Chenopodium hians's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB · GoaT552 Mbp

01Narrative

Chenopodium hians is a species of flowering plant in the family Amaranthaceae known by the common names hians goosefoot and gaping goosefoot. The Latin species name hians means "gaping".CalFlora Plant Names

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chenopodium hians has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes5

GenBank sequences9

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG236507.1 ↗322 bpCanada · 1958

ACGT

TTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGTCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCTCCCCCCACCCACCTGTGGGA …

Chenopodium hians voucher CCDB-23955-A07 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Chenopodium hians carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size551 591 999 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Chenopodium hians0.55 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · eflora

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Bassett, I. J. & C. W. CROMPTON. 1982. The genus Chenopodium in Canada. Canad. J. Bot. 60: 586–610.

CCDB · eflora

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bassett, I. J. & C. W. CROMPTON. 1982. The genus Chenopodium in Canada. Canad. J. Bot. 60: 586–610.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type173 records

Museum / vouchered133

Other40

Origin

Native40

Range

Area of Occupancy AOO488 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 6≤1 km 26≤10 km 13>10 km 2

47 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence133

10Collections & institutions

Holding institutions24 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	15
Bronx, US	10
Flagstaff, US	9
Claremont, US	8
DOI/NPS, Colonial National Historical Parklocation not on record	8
Provo, US	8
Albuquerque, US	8
Severin-McDaniel Insect Collectionlocation not on record	5
San Diego, US	5
Madison, US	4
Musee des Dinosaures d'Esperaza (Aude)location not on record	4
US	4
San Luis Obispo, US	4
CASlocation not on record	4
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
Vancouver, CA	2
Bloomington, US	2
Wuzhou, CN	2
Emporia, US	2
Riverside, US	2
Canadian Department of Agriculturelocation not on record	2
Northridge, US	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Victoria, CA	1
Pullman, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Turku, FI	1
Tempe, US	1
Santa Barbara, US	1
Chongqing Museumlocation not on record	1
Cambridge, US	1
Research Collection of B. A. Bennettlocation not on record	1
Truckee, US	1
Whitehorse, CA	1
University of Stellenboschlocation not on record	1

35 institutions · 125 of 133 vouchered records shown · 7 without an institution code

09Environmental DNA7 detections

Where the DNA of Chenopodium hians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Pond and environs. Worn out pasture. Wastela…dry prairieerect, scattered in open prairie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.80 °C 7.70–11.9

Seasonal swing summer↔winter30.1 °C

Max temp (day)14.5 °C 11.4–17.6

Min temp (night)5.60 °C 3.60–7.70

Precipitation63.8 mm/mo 51.1–76.5

Air humidity58.3 % 57.5–59.0

Moisture balance-21.7 mm/mo -35.0–-8.30

Vapour deficit573 Pa 445–701

Wind speed4.70 m/s 3.80–5.60

Cloud cover44.2 % 38.2–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)