Chenopodium album
speciesAt a glance
Occurrence records455 269
Data sources18
Biological traits75
DNA specimens167
eDNA detections97
Sources18 archives
Databases and archives Chenopodium album's data was compiled from.
WikipediaWikimedia Foundation18 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility455 257 records↗
OBISOcean Biodiversity Information System7 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics167 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources75 traits
Chemical compositionFooDB · LOTUS · NPASS5 651 compounds
Occurrence & distributionGBIF · OBIS · PBDB455 269 records
Environmental DNA2 datasets · 15 countries97 detections
DNA & barcodingBOLD · NCBI167 specimens
Genome at a glanceCCDB · GIFT · GoaT2 Gbp
Deep timePBDB5 fossils
01Narrative
Chenopodium strictum, the lateflowering goosefoot, is a species of annual herb in the family Amaranthaceae (pigweed). They have a self-supporting growth form and simple, broad leaves. Individuals can grow to 55 cm tall.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology24
Fruit width1.3 mm
Leaf length45 mm
Leaf length max100 mm
Leaf length min10 mm
Leaf mass102 mg
Leaf size514 mm²
⚠ sources differ — TRY: 514 mm² · LEDA: 2 059 mm² · GIFT: 2 390 mm²
Leaf width15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 25 mm
Petiole length10 cm
Plant height0.767 m
⚠ sources differ — GIFT: 0.767 m · AusTraits: 1 m · LEDA: 0.55 m · TRY: 0.33 m
Plant height generative0.559 m
Plant height max3 m
Plant height min0.1 m
Seed length1.25 mm
Seed length max1.5 mm
Seed length min1.1 mm
Seed mass0.66 mg
⚠ sources differ — TRY: 0.66 mg · LEDA: 0.555 mg · GIFT: 13.98 mg
Seed mass max1.6 mg
Seed mass min0.17 mg
Seed volume0.79 mm³
Seed volume max0.84 mm³
Seed volume min0.75 mm³
Seed width1.15 mm
⚠ sources differ — AusTraits: 1.15 mm · GIFT: 1.3 mm
Seed width max1.5 mm
Seed width min1.1 mm
Life cycle & reproduction17
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colourgreen
Flowering endOct
Flowering startJul
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number17 793
Self fertilizationabsent
Sex typemonoecious
⚠ sources differ — AusTraits: monoecious · GIFT: bisexual
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 800 m
Elevation mean2 138 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nutlet · GIFT: achene
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formlanceolate
Leaf shapelanceolate narrowly_ovate ovate rhomboidal
Mycorrhiza typeAMNM
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio12.07 g/g
Leaf c379 mg/g
Leaf dry-matter content (LDMC)156 mg/g
Leaf n36.3 mg/g
Leaf p4.3 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)26.29 mm²/mg
⚠ sources differ — TRY: 26.29 mm²/mg · LEDA: 17.3 mm²/mg · GIFT: 22.21 mm²/mg
Other traits7
Diaspore typemulti-seeded generative dispersule
Inflorescencepanicle
Leaf marginentire
Leaf spinesno
Leaf thornsno
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition5 651 compounds
Compounds documented for Chenopodium album across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids99
Glycerophospholipids57
Cinnamic acids and derivatives34
Purine nucleos(t)ides26
Pyridine alkaloids25
Documented compounds5 651 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Retinol | 11,600 IU | FooDB | |
| Potassium | 8,710 mg/100g | FooDB | |
| L-Glutamic acid | 1,919.9 mg/100g | FooDB | |
| Phosphorus | 1,877.65 mg/100g | FooDB | |
| Calcium | 1,844.5 mg/100g | FooDB | |
| L-Aspartic acid | 1,588.35 mg/100g | FooDB | |
| epsilon-Polylysine | 1,304.5 mg/100g | FooDB |
05DNA & barcoding167 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chenopodium album has left across the world's sequence archives.
At a glance
DNA specimens167
Marker genes11
GenBank sequences9
eDNA detections97
Countries19
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGTCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCTCCCCC …
Chenopodium album voucher PLT.0396 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★trnL★trnL-F★ITS7★ITS2atpF-atpHcp-trnL-intronrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Chenopodium album carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 044 019 999 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Chenopodium album2.04 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 54 n = 27
Ploidy2× / 6× cytotypes
Chromosome records18–1082n range54median54mode225records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 54118×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +19
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Schwarzová T., 1986: Chromosome numbers of some species of the genus Chenopodium L. from localities in Czechoslovakia. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 37-40.
CCDB · iapt — IAPT/IOPB Chromosome Data 1
CCDB · iapt
CCDB · brit-fl — Cole, M.J. Watsonia 5: 117-122 (1962)
CCDB · brit-fl — Cole, M.J. Opera Bot. 5: 363-373 (1961)
CCDB · brit-fl — Rahiminezhad, M.R. (1995)
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 551-555. Granado, C., T. Luque & J. Pastor.Lagascalia15(1): 133-136(1988).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1815
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1818
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · mediterranean
CCDB · ipcn-api-dl — Granado, C., T. Luque & J. Pastor. 1988. Números cromosómicos para la flora Española. 551--555. Lagascalia 15: 133–136.
CCDB · ipcn-api-dl — Sidhu, M. & S. S. Bir. 1983. Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1–13.
CCDB · ipcn-api-dl — Dvorak, F. 1987. Study of Chenopodium diversifolium (Aellen) Dvorak and of some hybrids with this species. Scripta Fac. Sci. Nat. Univ. Purkyn. Brun. 17: 401–446.
CCDB · ipcn-api-dl — Buttler, K. P. 1989. Chromosomenzahlen von Gefässpflanzen aus Hessen 4. Folge. Hess. Florist. Briefe 38: 11–14.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Palomino H., G., M. S. D., R. Bye & P. M. R. 1990. Cytogenetic distinction between Teloxys and Chenopodium (Chenopodiaceae). S. W. Naturalist 35: 351–357.
CCDB · ipcn-api-dl — Schwarzová, T. 1986. Chromosome numbers of some species of the genus Chenopodium L. from localities in Czechoslovakia. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 37–40.
CCDB · ipcn-api-dl — Lomonosova, M. N. & A. A. Krasnikov. 1994. Chromosome numbers in some species of genus Chenopodium (Chenopodiaceae) of the flora of Siberia. Bot. Žhurn. (Moscow & Leningrad) 79(3): 124–125.
CCDB · ipcn-api-dl — Al-Turki, T. A., S. F. Mehmood & S. A. Filfilan. 1999. IOPB chromosome data 15. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 31: 10.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Tanaka, N. Y. & N. TANAKA. 1980. Chromosome studies in Chionographis (Liliaceae). III. The mode of meiosis. Cytologia 45: 809–817.
CCDB · ipcn-api-dl — Dvorak, F. & F. Grull. 1978. Study of the number of chromosomes of Angiosperms 7. Scripta Fac. Sci. Nat. Univ. Purkyn. Brun. 1. 8: 23–46.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — SCHWARZOVA, T. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — CROMPTON, C. W. & I. J. BASSETT. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.
CCDB · ipcn-api-dl — Al-Turki, T. A., S. A. Filfilan & S. F. Mehmood. 2000. A cytological study of flowering plants from Saudi Arabia. Willdenowia 30: 339–358.
CCDB · ipcn-api-dl — Lomonosova, M. N. & A. A. Krasnikov. 2003. Chromosome numbers of the genus Chenopodium (Chenopodiaceae) in Siberia. Bot. Žhurn. (Moscow & Leningrad) 88(1): 130–131.
CCDB · ipcn-api-dl — Lomonosova, M. N., A. A. Krasnikov & S. A. Krasnikova. 2001. Chromosome numbers of Chenopodiaceae from Siberia. Bot. Žhurn. (Moscow & Leningrad) 86(9): 145–146.
CCDB · ipcn-api-dl — Lomonosova, M. N., S. A. Krasnikova, A. A. Krasnikov, A. L. Ebel & N. A. Rudaja. 2003. Chromosome numbers of the family members Chenopodiaceae representatives from Mongolia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 88(8): 113–115.
CCDB · ipcn-api-dl — Rahiminejad, M. R. & R. J. Gornall. 2004. Flavonoid evidence for allopolyploidy in the Chenopodium album aggregate (Amaranthaceae). Pl. Syst. Evol. 246: 77–87.
CCDB · ipcn-api-dl — Lomonosova. 2005. Chromosome numbers of Chenopodiaceae species from Russia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 90(7): 1132–1134.
+52 more references
2n 3662×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iapt +14
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iapt — IAPT/IOPB Chromosome Data 1
CCDB · iapt
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. X. Chenopodiaceae. Queirs, M.Bol. Soc. Brot. ser. 249: 121-142(1975).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1816
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · mediterranean
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · ipcn-api-dl — Runemark, H. 1996. Mediterranean chromosome number reports 6 (590--678). Fl. Medit. 6: 223–243.
CCDB · ipcn-api-dl — LABADIE, J. 1976a. Contribution à l'etude caryosystematique des espeees halophiles du littoral languedocier (plus precisement, especes appartenant à la classe des Salicornietea). These, Universite du Languedoc. 222 pp.
CCDB · ipcn-api-dl — Dvo|3rák, F. 1989. Study on Chenopodium strictum agg. Feddes Repert. 100: 197–234.
CCDB · ipcn-api-dl — Murin, A., I. Haberova & C. Zamsran. 1980. Karyological studies of some species of the Mongolian flora. Folia Geobot. Phytotax. 15: 395–405.
CCDB · ipcn-api-dl — GERVAIS, C. 1979. Le Chenopodium strictum Roth an Quebec et ses caracteres distinctifs. Naturaliste Canad. 106: 331–336.
CCDB · ipcn-api-dl — SCHWARZOVA, T. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Lomonosova, M. N. & A. A. Krasnikov. 2003. Chromosome numbers of the genus Chenopodium (Chenopodiaceae) in Siberia. Bot. Žhurn. (Moscow & Leningrad) 88(1): 130–131.
CCDB · ipcn-api-dl — Lomonosova, M. N., S. A. Krasnikova, A. A. Krasnikov, A. L. Ebel & N. A. Rudaja. 2003. Chromosome numbers of the family members Chenopodiaceae representatives from Mongolia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 88(8): 113–115.
CCDB · ipcn-api-dl — Rahiminejad, M. R. & R. J. Gornall. 2004. Flavonoid evidence for allopolyploidy in the Chenopodium album aggregate (Amaranthaceae). Pl. Syst. Evol. 246: 77–87.
CCDB · ipcn-api-dl — Lomonosova. 2006. Chromosome numbers of some Chenopodiaceae representatives of the flora of Russia. Bot. Žhurn. (Moscow & Leningrad) 91(11): 1757–1759.
CCDB · ipcn-api-dl — Rahiminejad. 2006. IAPT/IOPB chromosome data 1. Taxon 55(2): 444–445.
CCDB · ipcn-api-dl — Dvorak, F., F. Grull, K. Sutory & B. Dadakova. 1981. In Chromosome number reports LXXIII. Taxon 30:844.
CCDB · ipcn-api-dl — Buttler, K. P. 1989. Chromosomenzahlen von Gefässpflanzen aus Hessen 4. Folge. Hess. Florist. Briefe 38: 11–14.
CCDB · ipcn-api-dl — Dvorak, F. 1987. Study of Chenopodium diversifolium (Aellen) Dvorak and of some hybrids with this species. Scripta Fac. Sci. Nat. Univ. Purkyn. Brun. 17: 401–446.
CCDB · book-ipcn67-71 — MULLIGAN, G.A. 1969. In IOPB chromosome number reports XX. Taxon 18: 213-221.
CCDB · book-ipcn67-71 — KEENER, c.s. 1970. Documented plant chromosome numbers. 70: 1. Sida 3: 533-536.
CCDB · book-ipcn75-78 — Labadie 1976a
CCDB · book-ipcn75-78 — 54
CCDB · book-ipcn75-78 — Schwarzova 1978
CCDB · book-indian_vol1 — Cooper, G.O. 1935 ; Witte, M.B. 1947; Heiser, C.B. & Whitaker, T.W. 1948 ; Sorsa, V. 1962 ; Labadie, J.P. 1976
CCDB · eflora
CCDB · book-fedorov — Homsher 1963
CCDB · book-atlas-flowering-plants — G. 0. Cooper 1935, (G)V
CCDB · book-atlas-flowering-plants — Witte 1947
CCDB · kew — Ohri D. (pers. comm. 2002)
CCDB · CromoCat 2015 — Bhargava, H. R. (1936). The life-history of Chenopodium album L. Proc. Indiana Acad. Sci. 4: 179-200.
CCDB · CromoCat 2015 — Cooper, D. C. (1935a). Microsporogenesis and the development of the male gametes in Portulaca oleraceae. Amer. J. Bot. 22: 453-459.
CCDB · CromoCat 2015 — Giusti, L. (1964). Notas citotaxonómicas sobre Chenopodium album L. en Argentina. Darwiniana 13: 486-505.
CCDB · CromoCat 2015 — Labadie, J. P. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 636-639.
CCDB · CromoCat 2015 — Magulaev, A. Y. (1984). Cytotaxonomix study in some flowering plants of the North Caucasus. Bot. Žurn. 69: 511-517.
CCDB · CromoCat 2015 — Queirós, M. (1975a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. X. Chenopodiaceae. Bol. Soc. Brot. 49: 121-142.
+8 more references
2n 1844×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · iapt +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iapt
CCDB · fl-europaea — Ltfvkvist, 1963
CCDB · ipcn-api-dl — Sharma, A. K. & D. Dey. 1967. A comprehensive cytotaxonomic study on the family Chenopodiaceae. J. Cytol. Genet. 2: 114–127.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Probatova. 2005. Chromosome numbers of some dicotyledons of the flora of the Amur Region. Bot. Žhurn. (Moscow & Leningrad) 90(5): 779–792.
CCDB · ipcn-api-dl — Lomonosova. 2005. Chromosome numbers of Chenopodiaceae species from Russia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 90(7): 1132–1134.
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · book-ipcn67-71 — BASSETT, I.J., & C.W. CROMPTON. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797"":"
CCDB · book-ipcn67-71 — HAMET-AHTI L. & v. VIRRANKOSKI. 1970. Chromosome numbers of some vascular plants of north Finland. Ann. Bot. Fenn. 7: 177.
CCDB · book-indian_vol1 — . Winge, b. 1917a; p; Maude, P.F. 1939 ; LOve, A. & Uive, D. 1944b, 1956b ; Delay, C. 1947 ; Raghavan, R.S. & Arora, C.M. 1958; Josimovich, V.P. (Fedorov) : Bhattacharya, S.S. et al. 1911 ; Dvorak, F. & Griiii, F. 1978
CCDB · book-fedorov — Winge 1917a, b
CCDB · book-fedorov — Maude 1939
CCDB · book-fedorov — LOve A., LOve D. 1944h, 1956b
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Raghavan R. S., Arora 1958
CCDB · book-fedorov — BOCHMOBH'I 1963
CCDB · book-fedorov — Kawatani, Ohno 195&
CCDB · book-fedorov — Kjellmark 1934
CCDB · book-fedorov — Cole 1962
CCDB · book-atlas-flowering-plants — Maude 1940
CCDB · kew — Ohri D. (pers. comm. 2002)
CCDB · Cave1956 — Love & Love b
CCDB · Cave1958 — Raghavan & Arora 1958
CCDB · Cave1962 — Cole 1961, 1962
CCDB · CromoCat 2015 — Delay, C. (1947b). Recherches sur la structure des noyaux quiescents chez les Phanérogames. Rev. Cytol. et Cytophysiol. Vég. 10(1-4): 103-229.
CCDB · CromoCat 2015 — Dvo?ák, F. & Grüll, F. (1978). Study of the number of chromosomes of Angiosperms 7. Scr. Fac. Sci. Nat. Univ. Purkyn. Brun., Biol. 8: 23-46
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1944b). Cytotaxonomical studies on boreal plants. III. Some new chromosome numbers of Scandinavian plants. Arkiv. for Bot. Band 314(12): 1-22.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1956b). Cytotaxonomical conspectus of the Icelandic flora. Acta Horti Gothob. 20(4): 65-291.
CCDB · CromoCat 2015 — Maude, P. F. (1939). The Merton catalogue. A list of the chromosome numerals of species of British flowering plants. New Phytol. 38: 1-31.
CCDB · CromoCat 2015 — Maude, P. F. (1940). Chromosome numbers in some British plants. New Phytol. 39: 17-32.
CCDB · CromoCat 2015 — Mukherjee, K. K. (1986). A comparative study of two cytotypes of Chenopodium album in West Bengal, India. Canad. J. Bot. 64: 754-759.
CCDB · CromoCat 2015 — Probatova (2005). Chromosome numbers of some dicotyledons of the flora of the Amur Region Bot. Žhurn. (Moscow & Leningrad) 90(5): 779–792
CCDB · CromoCat 2015 — Raghavan, R. S. & C. M. Arora. (1958). Chromosome numbers in Indian medicinal plants. II. Proc. Ind. Acad. Sci. B 47: 352-358.
CCDB · CromoCat 2015 — Winge, Ö. (1917). The chromosomes. Their numbers and general importance. Compt. Rend. Trav. Carlsberg Lab., Sér. Physiol. 13: 131-275.
CCDB · CromoCat 2015 — Bhattacharyya, S. S., Khalifa, M. M. & Chaudhri, I. I. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXII]. Taxon 20(2/3): 349-350.
GIFT · GIFT (floras)
2n 3134×CCDB · book-fedorov
CCDB · book-fedorov — Cooper G. O. 1935
CCDB · book-fedorov — Witte 1947
CCDB · book-fedorov — Heiser. Whitaker 1948
CCDB · book-fedorov — Sorsa v. 1962
2n 271×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — 18
2n 1081×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Queirós, M. (1975a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. X. Chenopodiaceae. Bol. Soc. Brot. 49: 121-142.
n 2715×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +3
CCDB · ipcn-api-dl — Bassett, I. J. & C. W. CROMPTON. 1982. The genus Chenopodium in Canada. Canad. J. Bot. 60: 586–610.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — CROMPTON, C. W. & I. J. BASSETT. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.
CCDB · book-ipcn75-78 — Crompton & Bassett 1976
CCDB · book-ipcn73-74 — UOTILA, P. 1973. Chromosome counts on Chenopodium L. from SE Europe and SW Asia. Ann. Bot. Fenn. 10: 337-340.
CCDB · Cave1962 — Cole 1961, 1962
CCDB · Cave1962 — Cole 1962
CCDB · Cave1963 — Homsher 1963
CCDB · CromoCat 2015 — Crompton, C. W. & Bassett, I. J. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 645-646.
CCDB · CromoCat 2015 — Mukherjee, K. K. (1986). A comparative study of two cytotypes of Chenopodium album in West Bengal, India. Canad. J. Bot. 64: 754-759.
CCDB · CromoCat 2015 — Uotila, P. (1972). Chromosome counts on the Chenopodium album aggregate in Finland and NE Sweden. Ann. Bot. Fenn. 9: 29-32.
CCDB · CromoCat 2015 — Uotila, P. (1973). Chromosome counts on Chenopodium L. from SE Europe and SW Asia. Ann. Bot. Fenn. 10: 337-340.
n 95×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 · CCDB · Cave1958 +1
CCDB · book-ipcn67-71 — HAMET-AHTI L. & v. VIRRANKOSKI. 1970. Chromosome numbers of some vascular plants of north Finland. Ann. Bot. Fenn. 7: 177.
CCDB · book-ipcn75-78 — 18
CCDB · Cave1958 — Raghavan & Arora 1958
CCDB · CromoCat 2015 — Baquar, S. R. & Warsi, B. A. (1968). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XV]. Taxon 17(1): 91-104.
CCDB · CromoCat 2015 — Mukherjee, K. K. (1986). A comparative study of two cytotypes of Chenopodium album in West Bengal, India. Canad. J. Bot. 64: 754-759.
n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · Cave1963 +1
CCDB · ipcn-api-dl — Bassett, I. J. & C. W. CROMPTON. 1982. The genus Chenopodium in Canada. Canad. J. Bot. 60: 586–610.
CCDB · book-ipcn73-74 — UOTILA, P. 1973. Chromosome counts on Chenopodium L. from SE Europe and SW Asia. Ann. Bot. Fenn. 10: 337-340.
CCDB · Cave1963 — Sorsa 1962.
CCDB · Cave1963 — Homsher 1963
CCDB · CromoCat 2015 — Cooper, G. O. (1936b). Cytological studies in the Chenopodiaceae. I. Microsporogenesis and pollen development. Bot. Gaz. 97: 169-178.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Lomonosova, M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:898
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.3% BUSCO
07Deep time11.6–0 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range11.6–0 Ma Miocene → Holocene
Dated fossil finds5
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Chenopodium album. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type455 269 records
Wild obs. + sensor408 690
Museum / vouchered44 038
Cultivated / captive109
Fossil8
Other2 424
Origin
Native13 982
Introduced8 816
Range
Area of Occupancy AOO578 616 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy40% within 1 km
≤100 m 58 963≤1 km 75 663≤10 km 197 501>10 km 4 352
336 479 georeferenced · 72 211 without coordinates
Open the mapobservation + sensor408 690
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 3 940≤1 km 10 592≤10 km 15 907>10 km 899
31 338 georeferenced · 12 700 without coordinates
Open the institutions mapphysical evidence44 038
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy17% within 1 km
≤100 m 1≤10 km 4>10 km 1
6 georeferenced · 103 without coordinates
Open the mapnot free-living109
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions308 of 589 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 20 147 |
| DBF-NHMDlocation not on record | 1 409 |
| Berlin, DE | 888 |
| Beijing, CN | 797 |
| LDlocation not on record | 723 |
| Moscow State Universitylocation not on record | 686 |
| SLU Artdatabankenlocation not on record | 625 |
| BFLlocation not on record | 538 |
| Madison, US | 531 |
| Olocation not on record | 435 |
| Québec, CA | 379 |
| MeiseBGlocation not on record | 304 |
| Yangling, CN | 258 |
| Salzburg, AT | 239 |
| Oskarshamn, SE | 233 |
| St. Paul, US | 223 |
| Philadelphia, US | 219 |
| Chongqing Museumlocation not on record | 218 |
| Uniwersytet Warszawskilocation not on record | 214 |
| Nanjing, CN | 206 |
| Odawara, JP | 198 |
| Bern, CH | 185 |
| Adelaide, AU | 178 |
| Frankfurt am Main | 175 |
| Museo Entomologico de Leonlocation not on record | 169 |
| Université Lavallocation not on record | 168 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 168 |
| GJOlocation not on record | 165 |
| Pretoria, ZA | 159 |
| Saint Louis, US | 157 |
| Montréal, CA | 152 |
| Bloomington, US | 152 |
| Trondheim, NO | 151 |
| Oregon State Universitylocation not on record | 150 |
| BDBClocation not on record | 148 |
| Bergen, NO | 138 |
| Görlitz, DE | 133 |
| Jyväskylä, FI | 132 |
| Kunming, CN | 131 |
| Canberra, AU | 131 |
| Chiba, JP | 126 |
| València, ES | 123 |
| Christchurch, NZ | 123 |
| BRNUlocation not on record | 118 |
| MAlocation not on record | 111 |
| Barcelona, ES | 111 |
| Tartu, EE | 105 |
| Allentown, US | 104 |
| Nagano City, JP | 102 |
| Claremont, US | 101 |
| Ann Arbor, US | 98 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 96 |
| GMBAlocation not on record | 95 |
| Lausanne, CH | 95 |
| Philadelphia, US | 93 |
| Bronx, US | 93 |
| Shinshu Universitylocation not on record | 93 |
| San Diego, US | 91 |
| Brisbane, AU | 85 |
| Mount Annan, AU | 84 |
| BClocation not on record | 83 |
| TROMlocation not on record | 81 |
| Adam Mickiewicz University in Poznańlocation not on record | 80 |
| Wuzhou, CN | 79 |
| Córdoba, AR | 79 |
| Tokushima, JP | 78 |
| College of the Atlantic, Museumlocation not on record | 78 |
| Riverside, US | 78 |
| University of Wisconsinlocation not on record | 75 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 74 |
| South Kensington, GB | 74 |
| Chengdu, CN | 73 |
| Uniwersytet Śląski w Katowicachlocation not on record | 72 |
| Mlocation not on record | 71 |
| WTUlocation not on record | 70 |
| Auckland, NZ | 69 |
| Santa Barbara, US | 69 |
| Wlocation not on record | 67 |
| KMNlocation not on record | 66 |
| Tampa, US | 66 |
| Provincia di Livornolocation not on record | 65 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 63 |
| Burlington, US | 62 |
| University of New Hampshirelocation not on record | 61 |
| Pullman, US | 61 |
| Corvallis, US | 60 |
| Acadia Universitylocation not on record | 60 |
| University of Stellenboschlocation not on record | 59 |
| Xining, CN | 59 |
| Severin-McDaniel Insect Collectionlocation not on record | 58 |
| Mexico City, MX | 56 |
| Chapingo, MX | 56 |
| Tallinn, EE | 55 |
| WINlocation not on record | 54 |
| Wuhan, CN | 51 |
| Vancouver, CA | 51 |
| Chicago, US | 50 |
| Uppsala, SE | 50 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 50 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 50 |
| Chengdu, CN | 50 |
| Kensington, AU | 49 |
| Davis, US | 48 |
| Bando, JP | 47 |
| Victoria, CA | 47 |
| New Haven, US | 47 |
| Guangzhou, CN | 46 |
| Saint John, CA | 46 |
| Canadian Department of Agriculturelocation not on record | 46 |
| Denver, US | 45 |
| Wellington, NZ | 45 |
| Emporia, US | 45 |
| ASUlocation not on record | 44 |
| Urumqi, CN | 43 |
| Akita Prefectural Museumlocation not on record | 42 |
| Flagstaff, US | 41 |
| WNNUlocation not on record | 40 |
| Pocatello, US | 40 |
| Durango, MX | 37 |
| DOI/NPS, Greenbelt Parklocation not on record | 37 |
| McWane Science Centerlocation not on record | 37 |
| Uniwersytet Jagiellońskilocation not on record | 37 |
| Fukushima Universitylocation not on record | 37 |
| Jaén, ES | 36 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 36 |
| Taipei, TW | 36 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 36 |
| Williamsburg, US | 36 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 35 |
| Chapel Hill, US | 35 |
| Fort Worth, US | 34 |
| Hobart, AU | 34 |
| San Sebastián, ES | 34 |
| Chadron, US | 34 |
| Salamanca, ES | 34 |
| Moscow, US | 33 |
| Toronto, CA | 32 |
| University of Alberta Museumslocation not on record | 32 |
| San Luis Obispo, US | 31 |
| Karlsruhe, DE | 31 |
| Toyama, JP | 30 |
| Sanda, JP | 30 |
| Kochi, JP | 29 |
| CASlocation not on record | 29 |
| Bangkok, TH | 29 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 28 |
| CICYTEXlocation not on record | 28 |
| Provo, US | 28 |
| Austin, US | 28 |
| Albuquerque, US | 27 |
| Green Bay, US | 26 |
| Northeastern Forestry Universitylocation not on record | 26 |
| Garðabær, IS | 25 |
| National Institute of Biological Resourceslocation not on record | 25 |
| CJBGlocation not on record | 25 |
| Arcata, US | 24 |
| Spearfish, US | 24 |
| GZUlocation not on record | 23 |
| College Park, US | 22 |
| Boise, US | 22 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 22 |
| Mexico City, MX | 22 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 22 |
| Taipei, TW | 22 |
| Bozeman, US | 22 |
| JP | 22 |
| Tsukuba, JP | 21 |
| Cape Town, ZA | 21 |
| Seoul, KR | 21 |
| IWEP FEB RASlocation not on record | 20 |
| US | 20 |
| Texas Lutheran Universitylocation not on record | 20 |
| Lubbock, US | 20 |
| Zürich, CH | 20 |
| Logan, US | 19 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 19 |
| Badajoz, ES | 19 |
| Durban, ZA | 19 |
| PrivatHerblocation not on record | 19 |
| Entomological Society of Latvialocation not on record | 18 |
| Kathmandu, NP | 18 |
| Lanzhou, CN | 18 |
| Caldwell, US | 18 |
| Hangzhou, CN | 18 |
| KURAlocation not on record | 18 |
| Fredericton Stock Culture Collectionlocation not on record | 18 |
| Miami, US | 18 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 18 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 18 |
| Anchorage, US | 17 |
| Zacatecas, MX | 17 |
| Nagatoro-machi, Chichibu-gun, JP | 17 |
| Zürich, CH | 17 |
| PRClocation not on record | 17 |
| San Isidro, AR | 16 |
| Angwin, US | 16 |
| Staten Island, US | 16 |
| Jackson, US | 16 |
| Brookings, US | 16 |
| BIO-UNIPIlocation not on record | 16 |
| Shanxi Institute of Biologylocation not on record | 16 |
| NMBU:MINAlocation not on record | 16 |
| UGentlocation not on record | 15 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| EL PASO, US | 15 |
| Jiangxi College of Educationlocation not on record | 15 |
| Phyletisches Museum Jenalocation not on record | 15 |
| 15 | |
| Dekalb, US | 15 |
| Córdoba, ES | 15 |
| GB | 15 |
| Oulu, FI | 15 |
| Alicante, ES | 15 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| Institute of the biological problems of the North FEB RASlocation not on record | 14 |
| Keene State Universitylocation not on record | 14 |
| Siouxland Heritage Museumlocation not on record | 13 |
| Ciudad de México, MX | 13 |
| Armidale, AU | 13 |
| Juriquilla, MX | 13 |
| Irvine, US | 13 |
| Phoenix, US | 13 |
| Changsha, CN | 13 |
| Rotorua, NZ | 13 |
| Awka, NG | 13 |
| Beijing, CN | 12 |
| Pamplona, ES | 12 |
| ENTClocation not on record | 12 |
| Frauenfeld, CH | 12 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Uniwersytet Opolskilocation not on record | 12 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 12 |
| Millersville, US | 12 |
| Kew, GB | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Xiamen, CN | 12 |
| 东北师范大学自然博物馆location not on record | 11 |
| TAIElocation not on record | 11 |
| Tianjin Natural History Museumlocation not on record | 11 |
| Guilin, CN | 11 |
| John T. Waterhouse Herbariumlocation not on record | 11 |
| Missoula, US | 11 |
| Mississippi State, US | 11 |
| Granada, ES | 11 |
| Zapopan, MX | 11 |
| Fayetteville, US | 10 |
| Cheney, US | 10 |
| University of Guelph, OAC Herbariumlocation not on record | 10 |
| Hermosillo, MX | 10 |
| Columbia, US | 10 |
| ZRC-SAZUlocation not on record | 10 |
| Pittsburg, US | 10 |
| LfUlocation not on record | 9 |
| US | 9 |
| Vitoria, ES | 9 |
| Tilburg, NL | 9 |
| Durham, US | 9 |
| Beijing Normal Universitylocation not on record | 9 |
| San Angelo, US | 9 |
| Rishon Le Zion, IL | 9 |
| Norfolk, US | 9 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 9 |
| Davenport, US | 9 |
| Stockholm, SE | 9 |
| Culiacán, MX | 9 |
| Wuhan, CN | 9 |
| Kandalaksha State Nature Reservelocation not on record | 8 |
| Puebla, MX | 8 |
| Denton, US | 8 |
| Nanchong, CN | 8 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 8 |
| Whitewater, US | 8 |
| GAlocation not on record | 8 |
| Paris, FR | 8 |
| Nishihara, JP | 8 |
| Sevilla, ES | 8 |
| Shanghai, CN | 8 |
| Nishihara, JP | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Guasave, MX | 8 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 8 |
| Zhejiang Universitylocation not on record | 8 |
| Edinburgh, GB | 7 |
| Knoxville, US | 7 |
| Fulda, DE | 7 |
| Inner Mongolia Universitylocation not on record | 7 |
| Jena Microbial Resource Collectionlocation not on record | 7 |
| Bend, US | 7 |
| Tacoma, US | 7 |
| Istituto Agrario Castelnuovolocation not on record | 7 |
| Hudson, US | 7 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 7 |
| New Brunswick, US | 7 |
| Taipei, TW | 7 |
| Kirksville, US | 7 |
| Guiyang, CN | 7 |
| Iwate Prefectural Museumlocation not on record | 7 |
| Shanxi Universitylocation not on record | 7 |
| Lord Fairfax Community Collegelocation not on record | 7 |
| Tula State Universitylocation not on record | 7 |
| San Bernardino, US | 7 |
| KR | 6 |
| Bourges, FR | 6 |
| Yunnan Universitylocation not on record | 6 |
| Macomb, US | 6 |
| KIRMlocation not on record | 6 |
| Loja, EC | 6 |
| UIBlocation not on record | 6 |
| Sendai, JP | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Tromso University Museumlocation not on record | 6 |
| Cuenca, EC | 6 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 6 |
| Xian, CN | 6 |
| VALElocation not on record | 6 |
| IDElocation not on record | 6 |
| Montecillo, Texcoco, MX | 6 |
| Waverly, US | 6 |
| Anchorage, US | 6 |
| Nagasaki University - Fisherieslocation not on record | 6 |
| Little Rock, US | 6 |
| Umeå Universitylocation not on record | 6 |
| Chengdu, CN | 6 |
| Elocation not on record | 6 |
| Zhejiang Museum of Natural Historylocation not on record | 6 |
| QVMAGlocation not on record | 5 |
| Omachi Alpine Museumlocation not on record | 5 |
| Springfield, US | 5 |
| Shanghai, CN | 5 |
| Guangzhou, CN | 5 |
| Trois-Rivières, CA | 5 |
| Urumqi, CN | 5 |
| Peking Universitylocation not on record | 5 |
| KNAMlocation not on record | 5 |
| Ishikawa Museum of Natural Historylocation not on record | 5 |
| Portland, US | 5 |
| Tuscaloosa, US | 5 |
| H-Schuhwlocation not on record | 5 |
| National Biodiversity Institute, Costa Ricalocation not on record | 5 |
| J.F.Oberlin Universitylocation not on record | 5 |
| Lincoln, US | 5 |
| Harrisonburg, US | 5 |
| Zhengzhou, CN | 5 |
| Corrientes, AR | 5 |
| Lanzhou Institute of Desert Research, Academia Sinicalocation not on record | 5 |
| Hamilton, US | 5 |
| Whitehorse, CA | 4 |
| Ciudad de México, MX | 4 |
| Castelar, AR | 4 |
| Northridge, US | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 4 |
| Palmerston North, NZ | 4 |
| Mohonk Preservelocation not on record | 4 |
| US | 4 |
| Chicago, US | 4 |
| 云南省思茅市民族传统医药研究所location not on record | 4 |
| Durango, US | 4 |
| DMZ botanic gardenlocation not on record | 4 |
| Long Beach, US | 4 |
| Porrentruy, CH | 4 |
| Salvador, BR | 4 |
| Tempe, US | 4 |
| Central China Normal Universitylocation not on record | 4 |
| Osaka, JP | 4 |
| Honolulu, US | 4 |
| Mount Pleasant, US | 4 |
| Ypsilanti, US | 4 |
| Washington, US | 4 |
| Winterthur, CH | 4 |
| Chicago, US | 4 |
| Madrid, ES | 4 |
| Rocky Mountain Biological Laboratorylocation not on record | 4 |
| Grand Junction, US | 4 |
| UTPLlocation not on record | 3 |
| Regensburgische Botanische Gesellschaftlocation not on record | 3 |
| JBSlocation not on record | 3 |
| B.A. Bennett Herbariumlocation not on record | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Johnson City, US | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| Podgorica, ME | 3 |
| USFSlocation not on record | 3 |
| Kushiro City Museumlocation not on record | 3 |
| Palmerston, AU | 3 |
| Kingston, US | 3 |
| BISHlocation not on record | 3 |
| Ensenada, MX | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| AUAlocation not on record | 3 |
| University of Tennessee at Chattanoogalocation not on record | 3 |
| Herbario UTCEClocation not on record | 3 |
| Mexico City, MX | 3 |
| Dresden, DE | 3 |
| Hazara Universitylocation not on record | 3 |
| Jurica-Suchy Nature Museumlocation not on record | 3 |
| Cambridge, US | 3 |
| Glarus, CH | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| Parkville, AU | 3 |
| UoB-IBlocation not on record | 3 |
| La Paz, MX | 3 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| Sion, CH | 3 |
| Dehra Dun, IN | 3 |
| Bratislava, SK | 3 |
| Tomioka, JP | 3 |
| Museum of the Rockieslocation not on record | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| DULlocation not on record | 3 |
| Torreón, MX | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Jefferson City, US | 3 |
| Göteborg, SE | 3 |
| MMHNSRlocation not on record | 3 |
| Santa Cruz, US | 3 |
| BSBIlocation not on record | 2 |
| Pamplona, ES | 2 |
| Tlalnepantla, MX | 2 |
| Guiyang, CN | 2 |
| nbflocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 2 |
| Altos de Pipe, VE | 2 |
| Conway, US | 2 |
| University of Lethbridgelocation not on record | 2 |
| Quito, EC | 2 |
| Fairfax, US | 2 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 2 |
| Shenyang Agricultural Universitylocation not on record | 2 |
| Sevilla, ES | 2 |
| Valdosta State Universitylocation not on record | 2 |
| Morelia, MX | 2 |
| SZUlocation not on record | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| BGBMlocation not on record | 2 |
| H-Dunkellocation not on record | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| Gijón, ES | 2 |
| FJIDClocation not on record | 2 |
| MSB-3054location not on record | 2 |
| Wollongong, AU | 2 |
| San Jose, US | 2 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| University of Johannesburglocation not on record | 2 |
| Korea National Arboretumlocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Asheville, US | 2 |
| US | 2 |
| Otaru, JP | 2 |
| Dover, US | 2 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 2 |
| Austin, US | 2 |
| National Museums of Kenyalocation not on record | 2 |
| Hebei Normal Universitylocation not on record | 2 |
| Nunoa, Santiago, CL | 2 |
| MEXUlocation not on record | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Cincinnati, US | 2 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 2 |
| Smithfield, AU | 2 |
| Coimbra, PT | 2 |
| Orem, US | 2 |
| South African National Biodiversity Institutelocation not on record | 2 |
| NoColllocation not on record | 2 |
| Toluca, MX | 1 |
| UTFPR-CPlocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| SWlocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Bothell, US | 1 |
| Porto Alegre, BR | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Edmonton, CA | 1 |
| University of Balochistanlocation not on record | 1 |
| LNBG$location not on record | 1 |
| Monastir, TN | 1 |
| Montréal, CA | 1 |
| KNFHClocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| München, DE | 1 |
| Clemson, US | 1 |
| H-Hohlalocation not on record | 1 |
| ESP109location not on record | 1 |
| NSW Office of Environment and Heritagelocation not on record | 1 |
| ER-NBYlocation not on record | 1 |
| Fullerton, US | 1 |
| H-Meierottlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Los Angeles, US | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Minia, EG | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Museo universitario di Chietilocation not on record | 1 |
| PUC-RIOlocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Xinxiang, CN | 1 |
| ESALQlocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| San José, CR | 1 |
| Kuopio, FI | 1 |
| James Cook Townsvillelocation not on record | 1 |
| University of Agriculture, Faisalabadlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| KNFSClocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| KOMlocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| FLADlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Southwest Forestry Collegelocation not on record | 1 |
| IMMUlocation not on record | 1 |
| ifplocation not on record | 1 |
| Banyoles, ES | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| The Manitoba Museum, Botany Departmentlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Valparaiso, CL | 1 |
| Fargo, US | 1 |
| National Museum Waleslocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Dhaka, BD | 1 |
| Stephenville, US | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Maringá, BR | 1 |
| Qufu Normal Universitylocation not on record | 1 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 1 |
| OLAlocation not on record | 1 |
| Viña del Mar, CL | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| UChlocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| JBCLMlocation not on record | 1 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 1 |
| SCAUlocation not on record | 1 |
| Aarhus, DK | 1 |
| Mount Berry, US | 1 |
| Charleston Southern Universitylocation not on record | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| Ashland, US | 1 |
| Campo Mourão, BR | 1 |
| Batemans Bay, AU | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| CONCOLlocation not on record | 1 |
| Villa de Etla, MX | 1 |
| SEFlocation not on record | 1 |
| GHPG$location not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Turlock, US | 1 |
| Muzaffarabad, PK | 1 |
| FFPRIlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| ROM007location not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| ESP003location not on record | 1 |
| Oswego, US | 1 |
| Herb. BBGlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| UFRPElocation not on record | 1 |
| UESBlocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
589 institutions · 41 698 of 44 038 vouchered records shown · 1 841 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA97 detections
Where the DNA of Chenopodium album was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found97
Studies independent surveys2
Countries15
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 97 detections have coordinates
Open the map15 countries0
grassy area in open alkaline salt pondsDisturbed roadside gravel.Coastal sage scrub, grassland and riparian s…mustard, Bermuda grass, radish, horse weed, …allotmentSaline enriched disturbed areas of roadside …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.2 °C 8.30–25.1
Seasonal swing summer↔winter21.2 °C
Max temp (day)21.2 °C 11.9–30.7
Min temp (night)12.7 °C 4.60–18.7
Precipitation61.8 mm/mo 15.4–103
Air humidity59.1 % 49.0–63.7
Moisture balance-38.4 mm/mo -132–41.1
Vapour deficit804 Pa 447–1,477
Wind speed3.10 m/s 1.80–4.90
Cloud cover40.8 % 20.8–59.5
CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.