Chengiopanax sciadophylloides

(Franch. & Sav.) C.B.Shang & J.Y.Huang · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Araliaceae/Chengiopanax

At a glance

Occurrence records1 648

Data sources12

Biological traits18

DNA specimens60

eDNA detections25

Sources12 archives

Databases and archives Chengiopanax sciadophylloides's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 648 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics60 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS12 compounds

Occurrence & distributionGBIF1 648 records

Environmental DNA1 datasets · 1 countries25 detections

DNA & barcodingBOLD · NCBI60 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Chengiopanax sciadophylloides is a flowering tree in the family Araliaceae native to Japan. Previously included in the genus Eleutherococcus, it is distinguished from other members of that genus by not having spines or prickles and ITS sequence data confirmed the separation.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Leaf size42 134 mm²

Plant height7.08 m

Seed volume19 mm³

Seed volume max19 mm³

Seed volume min19 mm³

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment4

Climatesubtropical

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry6

Leaf c455 mg/g

Leaf dry-matter content (LDMC)323 mg/g

Leaf n20.33 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)23.47 mm²/mg

Wood density347 mg/cm³

03Chemical composition12 compounds

Compounds documented for Chengiopanax sciadophylloides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols4

Phytane diterpenoids1

Taraxerane triterpenoids1

Dihydroflavonols1

Caryophyllane sesquiterpenoids1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	LOTUS
(2S,3R)-3,5-dihydroxy-2-(4-hydroxyphenyl)-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	LOTUS
beta-Farnesene	present	LOTUS
beta-Sitosterol	present	LOTUS
Kaempferitrin	present	LOTUS
Kaempferol	present	LOTUS
Kaempferol 7-rhamnoside	present	LOTUS
N-1-Dotriacontanol	present	LOTUS
phytol	present	LOTUS
Quercetin 7-O-rhamnoside	present	LOTUS

05DNA & barcoding60 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chengiopanax sciadophylloides has left across the world's sequence archives.

At a glance

DNA specimens60

Marker genes4

GenBank sequences10

eDNA detections25

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC692988.1 ↗599 bpJapan · 1999

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Chengiopanax sciadophylloides TF<JPN>:TW018049 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7★ITStrnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Chengiopanax sciadophylloides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — KAWATANI, T., & T. OHNO. 1971. Chromosome numbers of Acanthopanax growing in Japan. Jap. Bot. 46: 349-350.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 648 records

Wild obs. + sensor1 262

Museum / vouchered382

Cultivated / captive4

Origin

Native1

Range

Area of Occupancy AOO3 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤100 m 26≤1 km 3≤10 km 608>10 km 408

1 045 georeferenced · 217 without coordinates

Open the mapobservation + sensor1 262

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 23≤10 km 92

115 georeferenced · 267 without coordinates

Open the institutions mapphysical evidence382

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nagano City, JP	79
Shinshu Universitylocation not on record	71
Toyama, JP	38
Iwate Prefectural Museumlocation not on record	21
Forestry and Forest Products Research Institutelocation not on record	21
JP	17
Fukushima Universitylocation not on record	16
Sendai, JP	9
Ishikawa Museum of Natural Historylocation not on record	9
Tokushima, JP	7
Otaru, JP	7
FFPRIlocation not on record	7
Tomioka, JP	6
Kochi, JP	5
Xiamen, CN	5
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	4
KIRMlocation not on record	3
Edinburgh, GB	2
SIHUlocation not on record	2
Omachi Alpine Museumlocation not on record	2
J.F.Oberlin Universitylocation not on record	2
University of Stellenboschlocation not on record	1
Kushiro City Museumlocation not on record	1
Sapporo, JP	1
Sagamihara, JP	1
Beijing, CN	1
Kew, GB	1

27 institutions · 339 of 382 vouchered records shown · 42 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA25 detections

Where the DNA of Chengiopanax sciadophylloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 12.8–24.5

Seasonal swing summer↔winter24.4 °C

Max temp (day)23.2 °C 16.1–27.4

Min temp (night)17.2 °C 8.40–20.5

Precipitation229 mm/mo 184–329

Air humidity65.8 % 62.7–66.6

Moisture balance124 mm/mo 40.9–218

Vapour deficit896 Pa 529–1,059

Wind speed2.30 m/s 1.70–3.20

Cloud cover42.4 % 34.9–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chengiopanax sciadophylloides

At a glance

Sources12 archives

Size & morphology5

Life cycle & reproduction3

Habitat & environment4

Physiology & chemistry6

Compound class profile5 classes

Documented compounds12 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 648 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 648 records