Chelone obliqua

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Chelone

At a glance

Occurrence records373

Data sources11

Biological traits11

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Chelone obliqua's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility373 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF373 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 84

01Narrative

Chelone obliqua est une espèce de plantes à fleurs de la famille des Plantaginacées (Plantaginaceae). C'est une robuste plante vivace originaire de l'Illinois. Elle s'est répandue dans le quart sud-est de l'Amérique du Nord, mais se fait rare à l'état sauvage dans certains états. Les horticulteurs commercialisent des cultivars et des hybrides à usage ornemental.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition8 compounds

Compounds documented for Chelone obliqua across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Cinnamic acids and derivatives $ Phenylethanoids3

Phenylethanoids2

Iridoids monoterpenoids1

Flavones1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,5R,6R)-2-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-6-(hydroxymethyl)oxane-3,4-dione	present	LOTUS
2-(3,4-Dihydroxyphenyl)ethyl beta-D-glucopyranoside	present	LOTUS
[(2R,3R,4R,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)-4-[(2S,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
Catalpol	present	LOTUS
cis-Acteoside	present	LOTUS
Decaffeoylverbascoside	present	LOTUS
Isocryptomerin	present	NPASS
Verbascoside	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chelone obliqua has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAF375164.1 ↗600 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGCCGAGGTGCGAGGGTCGCAAGACCCCCGTGCCGATATCCCT …

Chelone obliqua internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Chelone obliqua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 84 n = 42

Ploidypolyploid inferred

Chromosome records56–842n range84median84mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 842×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — COOPERRIDER, T.S., & G.A. MCCREADY. 1970. Chromosome numbers in Chelone (Scrophulariaceae). Brittonia 22: 175-183.

2n 561×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — COOPERRIDER, T.S., & G.A. MCCREADY. 1970. Chromosome numbers in Chelone (Scrophulariaceae). Brittonia 22: 175-183.

n 422×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — COOPERRIDER, T.S., & G.A. MCCREADY. 1970. Chromosome numbers in Chelone (Scrophulariaceae). Brittonia 22: 175-183.

n 281×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — COOPERRIDER, T.S., & G.A. MCCREADY. 1970. Chromosome numbers in Chelone (Scrophulariaceae). Brittonia 22: 175-183.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type373 records

Wild obs. + sensor235

Museum / vouchered133

Cultivated / captive5

Origin

Introduced2

Range

Area of Occupancy AOO1 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 60≤1 km 22≤10 km 119>10 km 11

212 georeferenced · 23 without coordinates

Open the mapobservation + sensor235

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 23≤1 km 28≤10 km 27>10 km 4

82 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence133

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 3 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	21
Chapel Hill, US	15
DBF-NHMDlocation not on record	12
Knoxville, US	9
LDlocation not on record	8
Philadelphia, US	8
University of Stellenboschlocation not on record	5
WTUlocation not on record	5
Olocation not on record	5
Oskarshamn, SE	3
Moscow State Universitylocation not on record	2
Bangkok, TH	2
Williamsburg, US	2
Norfolk, US	2
Chongqing Museumlocation not on record	2
Bergen, NO	2
Stockholm, SE	1
Columbia, US	1
BRNUlocation not on record	1
Tampa, US	1
Denver, US	1
Dekalb, US	1
Burlington, US	1
Bronx, US	1
Davenport, US	1
US	1
Nijmegen, NL	1
GB	1
Richmond, US	1
Flagstaff, US	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
St. Paul, US	1
Cheney, US	1
Tuscaloosa, US	1
KMNlocation not on record	1
Trondheim, NO	1
Longwood Universitylocation not on record	1

37 institutions · 124 of 133 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Chelone obliqua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)