Chelidonium majus
speciesAt a glance
Occurrence records525 486
Data sources13
Biological traits70
DNA specimens60
eDNA detections1 071
Sources13 archives
Databases and archives Chelidonium majus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility525 486 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 071 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics60 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources70 traits
Chemical compositionLOTUS · NPASS151 compounds
Occurrence & distributionGBIF525 486 records
Environmental DNA2 datasets · 9 countries1 071 detections
DNA & barcodingBOLD · NCBI60 specimens
Genome at a glanceCCDB · GoaT · NCBI1.2 Gbp
01Narrative
Chelidonium majus, la Grande chélidoine ou Grande éclaire, Chélidoine élevée ou Herbe à la verrue, est une espèce plantes à fleurs de la famille des Papavéracées. On l'appelle aussi herbe aux verrues ou herbe à verrues car son latex jaune-orangé toxique est utilisé pour éliminer les verrues.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology27
Fruit length35 mm
Fruit length max50 mm
Fruit length min20 mm
Fruit width2.5 mm
Fruit width max3 mm
Fruit width min2 mm
Leaf length50 mm
Leaf length max200 mm
Leaf length min20 mm
Leaf mass240 mg
Leaf size9 983 mm²
⚠ sources differ — TRY: 9 983 mm² · LEDA: 9 226 mm² · GIFT: 9 226 mm²
Leaf width80 mm
Leaf width max100 mm
Leaf width min10 mm
Plant height0.506 m
⚠ sources differ — GIFT: 0.506 m · LEDA: 0.5 m · TRY: 0.732 m
Plant height generative0.575 m
Plant height max1 m
Plant height min0.3 m
Seed length1.43 mm
Seed length max1.5 mm
Seed length min1 mm
Seed mass0.742 mg
⚠ sources differ — TRY: 0.742 mg · LEDA: 0.813 mg · GIFT: 0.733 mg
Seed mass max0.91 mg
Seed mass min0.51 mg
Seed volume0.47 mm³
Seed volume max0.47 mm³
Seed volume min0.47 mm³
Life cycle & reproduction17
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dispersal typeanimal
Flower colouryellow
Flower length max12 mm
Flower length min7 mm
Flowering endJul
Flowering startMay
Life formperennial
Life spanAnnuals or biennials
⚠ sources differ — TRY: Annuals or biennials · LEDA: perennials · GIFT: perennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number761
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 200 m
Elevation mean1 350 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTLowland
Leaf formpinnate
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio11.47 g/g
Leaf c487 mg/g
Leaf dry-matter content (LDMC)202 mg/g
⚠ sources differ — TRY: 202 mg/g · LEDA: 186 mg/g
Leaf n42.48 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)44.48 mm²/mg
⚠ sources differ — TRY: 44.48 mm²/mg · LEDA: 46.87 mm²/mg · GIFT: 42.61 mm²/mg
Other traits3
Diaspore typegenerative dispersule
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition151 compounds
Compounds documented for Chelidonium majus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Isoquinoline alkaloids55
Flavonols22
Isoquinoline alkaloids $ Protoberberine alkaloids12
Cinnamic acids and derivatives9
Isoquinoline alkaloids $ Protopine alkaloids4
Documented compounds151 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+-)-6-Acetonyldihydrochelerythrine | present | LOTUS | |
| (+-)-Stylopine | present | LOTUS | |
| (+-)-Tetrahydroberberine | present | NPASS | |
| (13R)-13-ethoxy-1,2,4-trimethoxy-12-methyl-13H-[1,3]benzodioxolo[5,6-c]phenanthridine | present | LOTUS | |
| (13S)-1,2-dimethoxy-12-methyl-13H-[1,3]benzodioxolo[5,6-c]phenanthridin-13-ol | present | LOTUS | |
| (1R,12R,13S)-12-hydroxy-24-methyl-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-2,4(8),9,14(22),15,17(21)-hexaen-23-one | present | LOTUS | |
| (1R,12S,13S)-3-methoxy-24-methyl-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-2,4(8),9,14(22),15,17(21)-hexaen-12-ol | present | LOTUS | |
| (1R,13S,24S)-12-methyl-5,7,17,19-tetraoxa-12-azahexacyclo[11.11.0.02,10.04,8.014,22.016,20]tetracosa-2,4(8),9,14,16(20),21-hexaen-24-ol | present | LOTUS | |
| (1R,17S)-15-methyl-7,9,19,21-tetraoxa-15-azapentacyclo[15.7.0.04,12.06,10.018,22]tetracosa-4,6(10),11,18(22),23-pentaen-3-one | present | LOTUS | |
| (1S,12S,13R)-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-2,4(8),9,14(22),15,17(21)-hexaen-12-ol | present | LOTUS |
05DNA & barcoding60 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chelidonium majus has left across the world's sequence archives.
At a glance
DNA specimens60
Marker genes11
GenBank sequences10
eDNA detections1 071
Countries9
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCTAGGCCATCCGGCTGAGGGCACGCCTGCCTGGGCGTCACGCACTGAGTCGCCCCT …
Chelidonium majus subsp. majus voucher PLT.0054 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK7★rbcL1★rbcLa★trnL-F★ITS2★ITS1★ITS2atpF-atpHcp-trnL-intronrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Chelidonium majus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 232 280 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Chelidonium majus1.23 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidy2× diploid · measured
Chromosome records10–362n range12median12mode118records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1294×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +16
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — KIEFT B., LOON J.C. - 1978. IOPB chromosome number reports LXII.. Taxon , 27(5/6): 524-525.
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Šimková Ľ., 2007: [New records in Carum, Chelidonium, Epilobium, Lathyrus, Linaria, Lychnis, Picris, Primula, Scorzoneroides, Sonchus, Vicia, and Viola], pp. 178, 189, 239, 358, 371, 380, 437, 469, 531, 554, 614, 616, 617, 620. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Jinno, J. Mem. Ehime Univ., Sect. 2, Nat. Sci., B 6(2): 57-61 (1969)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XVII. Papaveraceae Queirs, M.Bol. Soc. Brot. ser. 254: 153-171(1980).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1702
CCDB · fl-europaea — Lbvkvist, 1963
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · book-ipcn65 — Ernst 1965
CCDB · ipcn-api-dl — Krahulcova, A. 1982. Cytotaxonomic study of Chelidonium majus L. s.l. Folia Geobot. Phytotax. 17: 237–268.
CCDB · ipcn-api-dl — Laane, M. M. & T. Lie. 1985. Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7–15.
CCDB · ipcn-api-dl — Stoeva, M. P. 1985. Chromosome numbers of Bulgarian angiosperms. Fitologija 30: 78–79.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Queiros, M. 1980. Números cromosómicos para la Flora Portuguesa, 38-63. Bol Soc. Brot. ser. 2, 54: 47–64.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1983. Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329–333.
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Safonova, I. N. 1991. Chromosome numbers in some species of the family Papaveraceae. Bot. Žhurn. (Moscow & Leningrad) 76: 904–905.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Pastor, J. 1979. In Numeros cromosomicos para la flora Espanola. 84-120. Lagascalia 9:115–130.
CCDB · ipcn-api-dl — TILQUIN, J. P. 1981a. An unusual case of a complex heterozygote presenting no taxonomical S problem in Chelidonium majus L. (Papaveraceae). Experientia (Basel) 37: 341–342.
CCDB · ipcn-api-dl — Kurosawa, S. 1979. Notes on chromosome numbers of Spermatophytes II. J. Jap. Bot. 54: 155–160.
CCDB · ipcn-api-dl — LEE, Y. N. 1967. Chromosome numbers of flowering plants in Korea. J. Korean Res. Inst. Ewha Women's Univ. 11: 455–478.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — KOZUHAROV, s.' M. POPOVA, & B. KUZMANOV. 1968. Cytotaxonomic studies on Bulgarian flowering plants. Genetics & Plant Breeding 1: 251-255.
CCDB · book-ipcn67-71 — MESICEK, J., & J. SOJAK. 1969. Chromosome counts of some Mongolian plants. Folia Geobot. Phytotax., Praha 4: 55-86.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1967. Chromosome numbers of flowering plants in the Netherlands III. Proc. Roy. Neth. Acad. Sci. Ser. c. 70: 7-20.
CCDB · book-ipcn67-71 — SKALINSKA, M., A. JANKUN, H. WCISLO ET AL. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · book-ipcn67-71 — VAN LOON, J.C., T.W.J. GADELLA, & E. KLIPHUIS. 1971. Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1975
+49 more references
2n 1021×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +4
CCDB · iapt — IAPT/IOPB Chromosome Data 2
CCDB · ipcn-api-dl — Ono, K. & S. Uehara. 1982. Induction of adventitious buds in cultured petal explants of Chelidonium majus L. Bot. Mag. (Tokyo) 95: 195–202.
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Starodubtsev, V. N. 1989. Chromosome numbers in species of the families Aceraceae, Brassicaceae, Cyperaceae, Euphorbiaceae, Papaveraceae and Ranunculaceae from the Soviet far east. Bot. Žhurn. (Moscow & Leningrad) 74: 1674–1675.
CCDB · ipcn-api-dl — Sha, W., L. h. Wang, X. j. Yang, X. l. Qi, G. h. Ma & D. y. Zhao. 1995. Chromosome numbers of 20 species from northeast China. J. Wuhan Bot. Res. 32(2): 180–182.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, F. h. Xue, L. y. Wang, J. f. Yun & X. q. Fu. 2000. The chromosome numbers and natural distribution of 38 forage plants in north China. Grassl. China 2000(5): 1–5.
CCDB · ipcn-api-dl — TILQUIN, J. P. 1981. Aspects particuliers de la catenation des chromosomes chez Chelidonium majus. Bull. Soc. Roy. Bot. Belgique 114: 176–180.
CCDB · ipcn-api-dl — Gagnidze. 2006. Chromosome numbers of some species of the Georgian flora. Bot. Žhurn. (Moscow & Leningrad) 91(12): 1928–1929.
CCDB · ipcn-api-dl — Gagnidze. 2006. IAPT/IOPB chromosome data 2. Taxon 55(3): 757.
CCDB · book-ipcn66 — Sokolovskaya 1966
CCDB · book-ipcn67-71 — LEE, Y.N. 1967. Chromosome numbers of flowering plants in Korea (1) J. Korean Cult. Res. Inst. 11: 455-478.
CCDB · book-ipcn75-78 — Kartashova et al. 1974
CCDB · Cave1963 — Jinno 1963
CCDB · CromoCat 2015 — Gagnidze, R., Gviniashvili, T. & Jinjolia, L. (2006). IAPT/IOPB Chromosome Data 2 Taxon 55(3): 757-758
CCDB · CromoCat 2015 — Kartashova, N. N., Malakhova, L. A., Koslova, A. A. & Dubrova, N. A. (1974b). Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk 47-53.
CCDB · CromoCat 2015 — Lee, Y. N. (1967). Chromosome numbers of flowering plants in Korea (1). J. Korean Cult. Res. Inst. 11: 455-478.
CCDB · CromoCat 2015 — Ono, K. & S. Uehara (1982). Induction of adventitious buds in cultured petal explants of Chelidonium majus L. Bot. Mag. (Tokyo) 95: 195–202
CCDB · CromoCat 2015 — Sha, W., L.-h. Wang, X.-j. Yang, X.-l. Qi, G.-h. Ma & D.-y. Zhao (1995). Chromosome numbers of 20 species from northeast China Journal of Wuhan Botanical Research 32(2): 180-182
CCDB · CromoCat 2015 — Starodubtsev, V. N. (1989). Chromosome numbers in species of the families Aceraceae, Brassicaceae, Cyperaceae, Euphorbiaceae, Papaveraceae and Ranunculaceae from the Soviet far east. Bot. Žhurn. (Moscow & Leningrad) 74: 1674–1675
CCDB · CromoCat 2015 — Tilquin, J. P. (1981). Aspects particuliers de la caténation des chromosomes chez Chelidonium majus L. Bull. Soc. Roy. Bot. Belg. 114: 176-180.
CCDB · CromoCat 2015 — Yan, G.-x., S.-z. Zhang, F.-h. Xue, L.-y. Wang, J.-f. Yun & X.-q. Fu (2000). The chromosome numbers and natural distribution of 38 forage plants in north China Grassland of China [Zhongguo caoyuan] 2000(5): 1-5
2n 362×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
2n 161×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 624×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 116-120. Pastor Daz, J.Lagascalia9(1): 128-130(1979).
CCDB · ipcn-api-dl — KAPOOR, B. M. 1982. In IOPB chromosome number reports LXXIV. Taxon 31: 119–120.
CCDB · ipcn-api-dl — Kapoor, B. M. & C. Gerrais. 1982. Liste annotée de nombres chromosomiques de la flore vasculaire du nord- est de l'Amérique. III. Naturaliste Canad. 109: 91–101.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Pastor, J. 1979. In Numeros cromosomicos para la flora Espanola. 84-120. Lagascalia 9:115–130.
CCDB · ipcn-api-dl — TILQUIN, J. P. 1981a. An unusual case of a complex heterozygote presenting no taxonomical S problem in Chelidonium majus L. (Papaveraceae). Experientia (Basel) 37: 341–342.
CCDB · ipcn-api-dl — Kurosawa, S. 1979. Notes on chromosome numbers of Spermatophytes II. J. Jap. Bot. 54: 155–160.
CCDB · ipcn-api-dl — Vázquez, F. M., S. Ramos, E. Doncel, J. Blanco & E. Balbuena. 2001. IOPB chromosome data 17. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 33: 26.
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
CCDB · Cave1956supp — Larsen 1954b
CCDB · Cave1959 — SUzuki & Masut. 1959
CCDB · Cave1959 — Thaler 1959
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Bowden, W. M. (1945). A list of chromosome numbers in higher plants. II. Menispermaceae to Verbenaceae. Amer. J. Bot. 32: 191-201.
CCDB · CromoCat 2015 — Cauderon, Y. (1958). Étude cytogénétique des Agropyrum français et de leurs hybrides avec les blés. Ann. Inst. Natl. Rech. Agron., Ser. B. 8: 389-543.
CCDB · CromoCat 2015 — Hill, L. M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 17-19.
CCDB · CromoCat 2015 — Kapoor, B. M. & Gervais, C. (1982). Liste annotée de nombres chromosomiques de la flore vasculaire du Nord-Est de l'Amérique. III. Naturaliste Canad. 109: 91-101.
CCDB · CromoCat 2015 — Kapoor, B. M. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIV]. Taxon 31(1): 119-120.
CCDB · CromoCat 2015 — Larsen, K. (1954a). Chromosome numbers of some European flowering plants. Bot. Tidsskr. 50(2): 163-164.
CCDB · CromoCat 2015 — Pastor Díaz, J. (1979). Números cromosómicos para la flora española, 116-120. Lagascalia 9(1): 128-130.
CCDB · CromoCat 2015 — Sorsa, V. (1962). Chromosomenzahlen Finnischer Kormophyten, I. Ann. Acad. Sci. Fenn., Sér. A 58: 1-14.
CCDB · CromoCat 2015 — Vázquez, F. M., S. Ramos, E. Doncel, J. Blanco & E. Balbuena. (2001). IOPB Chromosome Data 17 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 33: 26-27.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.852 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type525 486 records
Wild obs. + sensor513 131
Museum / vouchered11 084
Cultivated / captive64
Other1 207
Origin
Native495
Introduced6 489
Range
Area of Occupancy AOO642 036 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 192 496≤1 km 53 694≤10 km 153 396>10 km 4 276
403 862 georeferenced · 109 269 without coordinates
Open the mapobservation + sensor513 131
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 572≤1 km 1 711≤10 km 3 677>10 km 750
6 710 georeferenced · 4 374 without coordinates
Open the institutions mapphysical evidence11 084
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy4% within 1 km
≤100 m 1≤10 km 5>10 km 17
23 georeferenced · 41 without coordinates
Open the mapnot free-living64
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions166 of 319 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 547 |
| Helsinki, FI | 544 |
| BFLlocation not on record | 378 |
| Moscow State Universitylocation not on record | 349 |
| BIO-UNIPIlocation not on record | 345 |
| LDlocation not on record | 299 |
| Beijing, CN | 286 |
| Philadelphia, US | 252 |
| Chongqing Museumlocation not on record | 235 |
| Olocation not on record | 196 |
| Uniwersytet Warszawskilocation not on record | 170 |
| KMNlocation not on record | 166 |
| Salzburg, AT | 149 |
| MeiseBGlocation not on record | 142 |
| Görlitz, DE | 134 |
| Turku, FI | 132 |
| Tsukuba, JP | 115 |
| Oskarshamn, SE | 103 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 95 |
| València, ES | 94 |
| Kuopio, FI | 90 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 82 |
| Oulu, FI | 81 |
| SLU Artdatabankenlocation not on record | 80 |
| Yangling, CN | 66 |
| MAlocation not on record | 59 |
| Berlin, DE | 58 |
| Trondheim, NO | 56 |
| Bern, CH | 56 |
| Bergen, NO | 54 |
| Barcelona, ES | 50 |
| Durham, US | 50 |
| Entomological Society of Latvialocation not on record | 49 |
| Provincia di Livornolocation not on record | 46 |
| New Haven, US | 43 |
| Tartu, EE | 42 |
| Madison, US | 42 |
| Uniwersytet Opolskilocation not on record | 39 |
| Museo Entomologico de Leonlocation not on record | 39 |
| Tallinn, EE | 37 |
| South Kensington, GB | 35 |
| College Park, US | 35 |
| Jyväskylä, FI | 35 |
| Québec, CA | 34 |
| BDBClocation not on record | 34 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 34 |
| TUR-Alocation not on record | 32 |
| GJOlocation not on record | 32 |
| Pamplona, ES | 31 |
| Nanjing, CN | 30 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 28 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 27 |
| CICYTEXlocation not on record | 27 |
| Karlsruhe, DE | 27 |
| UGentlocation not on record | 27 |
| ISAlocation not on record | 26 |
| Tampere, FI | 26 |
| Ann Arbor, US | 24 |
| Auckland, NZ | 24 |
| Xining, CN | 24 |
| BRNUlocation not on record | 23 |
| Kunming, CN | 23 |
| Badajoz, ES | 22 |
| BClocation not on record | 22 |
| Wlocation not on record | 22 |
| Urumqi, CN | 21 |
| Allentown, US | 21 |
| Toronto, CA | 20 |
| Bronx, US | 20 |
| Uppsala, SE | 19 |
| Saint Louis, US | 17 |
| Beijing Normal Universitylocation not on record | 17 |
| St. Paul, US | 17 |
| Montréal, CA | 16 |
| Acadia Universitylocation not on record | 16 |
| Bloomington, US | 16 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 16 |
| Burlington, US | 15 |
| Zhengzhou, CN | 15 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| Mlocation not on record | 14 |
| Uniwersytet Jagiellońskilocation not on record | 14 |
| Guangzhou, CN | 14 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 14 |
| Tampa, US | 14 |
| University of Stellenboschlocation not on record | 13 |
| Xian, CN | 13 |
| Philadelphia, US | 13 |
| Université Lavallocation not on record | 12 |
| Lanzhou, CN | 12 |
| Porvoo, FI | 12 |
| KIWElocation not on record | 12 |
| Frankfurt am Main | 12 |
| Bangkok, TH | 11 |
| Zürich, CH | 11 |
| DBF-NHMDlocation not on record | 11 |
| Wuhan, CN | 11 |
| Millersville, US | 11 |
| CJBGlocation not on record | 10 |
| TROMlocation not on record | 10 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| Keene State Universitylocation not on record | 10 |
| Porrentruy, CH | 10 |
| Urumqi, CN | 10 |
| Tula State Universitylocation not on record | 10 |
| Xinxiang, CN | 10 |
| WNNUlocation not on record | 10 |
| Christchurch, NZ | 10 |
| Staten Island, US | 9 |
| College of the Atlantic, Museumlocation not on record | 9 |
| Shanxi Institute of Biologylocation not on record | 9 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 9 |
| Salamanca, ES | 9 |
| WTUlocation not on record | 9 |
| Iwate Prefectural Museumlocation not on record | 9 |
| Madrid, ES | 9 |
| Saint John, CA | 8 |
| Tianjin Natural History Museumlocation not on record | 8 |
| Alicante, ES | 8 |
| Xian, CN | 8 |
| Vitoria, ES | 8 |
| Logan, US | 8 |
| McWane Science Centerlocation not on record | 8 |
| Davenport, US | 7 |
| Bourges, FR | 7 |
| Universidad Católica de Santa Maríalocation not on record | 7 |
| Nishihara, JP | 7 |
| Guilin, CN | 7 |
| Denver, US | 7 |
| Wellington, NZ | 7 |
| NMBU:MINAlocation not on record | 7 |
| Hudson, US | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Beijing, CN | 7 |
| Vancouver, CA | 7 |
| ENTClocation not on record | 6 |
| SMMUlocation not on record | 6 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Williamsburg, US | 6 |
| Beijing Natural History Museumlocation not on record | 6 |
| Dekalb, US | 6 |
| Blumenau, BR | 6 |
| Taipei, TW | 6 |
| UIBlocation not on record | 5 |
| PrivatHerblocation not on record | 5 |
| Granada, ES | 5 |
| Inner Mongolia Universitylocation not on record | 5 |
| Seoul, KR | 5 |
| Royal Botanical Gardenslocation not on record | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Forssa, FI | 5 |
| Norfolk, US | 4 |
| Riverside, US | 4 |
| Dresden, DE | 4 |
| Stockholm, SE | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| New Brunswick, US | 4 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 4 |
| Hobart, AU | 4 |
| Chengdu, CN | 4 |
| Tilburg, NL | 4 |
| JBSlocation not on record | 4 |
| Frauenfeld, CH | 4 |
| Wuzhou, CN | 4 |
| Heilongjiang Academy of Scienceslocation not on record | 4 |
| Pullman, US | 4 |
| GZUlocation not on record | 4 |
| Glarus, CH | 4 |
| BSBIlocation not on record | 4 |
| University of Alberta Museumslocation not on record | 4 |
| University of New Hampshirelocation not on record | 3 |
| Guangzhou, CN | 3 |
| Salvador, BR | 3 |
| Brookings, US | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| US | 3 |
| Kew, GB | 3 |
| BAYLUlocation not on record | 3 |
| Missoula, US | 3 |
| Kingston, US | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Paris, FR | 3 |
| CASlocation not on record | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| JMSlocation not on record | 3 |
| Jaén, ES | 3 |
| Whitehorse, CA | 3 |
| Hamilton, US | 3 |
| xjulocation not on record | 2 |
| ESP109location not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Chicago, US | 2 |
| Santiago de Compostela, ES | 2 |
| Chapel Hill, US | 2 |
| Fulda, DE | 2 |
| UoB-IBlocation not on record | 2 |
| Columbia, US | 2 |
| Victoria, CA | 2 |
| Zürich, CH | 2 |
| Rovaniemi, FI | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Siouxland Heritage Museumlocation not on record | 2 |
| Claremont, US | 2 |
| Winterthur, CH | 2 |
| Shanxi Universitylocation not on record | 2 |
| Clemson, US | 2 |
| Moscow, US | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| Flagstaff, US | 2 |
| Boise, US | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Mount Annan, AU | 2 |
| EL PASO, US | 2 |
| Peking Universitylocation not on record | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Fairfax, US | 2 |
| Whitewater, US | 2 |
| Portland, US | 2 |
| Tomioka, JP | 2 |
| York University, Packer Collectionlocation not on record | 2 |
| Oswego, US | 2 |
| Museum of the Rockieslocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Pittsburg, US | 2 |
| Shanghai, CN | 2 |
| Philadelphia, US | 2 |
| Ivano-Frankove, UA | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| nbflocation not on record | 2 |
| ifplocation not on record | 2 |
| Sion, CH | 2 |
| Ypsilanti, US | 1 |
| Göteborg, SE | 1 |
| nlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Green Bay, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Kushiro City Museumlocation not on record | 1 |
| Shanghai, CN | 1 |
| Nijmegen, NL | 1 |
| Monastir, TN | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| HUFDlocation not on record | 1 |
| Montréal, CA | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| NEAUlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Ischia Marine Centrelocation not on record | 1 |
| Changsha, CN | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| FLADlocation not on record | 1 |
| Xiamen, CN | 1 |
| Palmerston North, NZ | 1 |
| Boumlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Awka, NG | 1 |
| Emporia, US | 1 |
| PUC-RSlocation not on record | 1 |
| UFSClocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Pamplona, ES | 1 |
| Cambridge, US | 1 |
| Sevilla, ES | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Rotorua, NZ | 1 |
| Miami, US | 1 |
| Ilhéus, BR | 1 |
| Banyoles, ES | 1 |
| Criciúma, BR | 1 |
| Little Rock, US | 1 |
| CEPLAClocation not on record | 1 |
| CJBNlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| UNESClocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Cheney, US | 1 |
| Pelotas, BR | 1 |
| Podgorica, ME | 1 |
| Nishihara, JP | 1 |
| ROM020location not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Long Beach, US | 1 |
| Due West, US | 1 |
| Mexico City, MX | 1 |
| SWlocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| GAlocation not on record | 1 |
| San Angelo, US | 1 |
| Mohonk Preservelocation not on record | 1 |
| Komarov Botanical Institutelocation not on record | 1 |
| Coimbra, PT | 1 |
| H-Wolflocation not on record | 1 |
| HUN003location not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Corvallis, US | 1 |
| UFBAlocation not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
319 institutions · 9 758 of 11 084 vouchered records shown · 973 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA1 071 detections
Where the DNA of Chelidonium majus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1 071
Studies independent surveys2
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 071 detections have coordinates
Open the map9 countries0
Pine forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.4 °C 11.6–16.2
Seasonal swing summer↔winter22.8 °C
Max temp (day)17.7 °C 15.8–20.0
Min temp (night)10.2 °C 6.50–13.7
Precipitation69.3 mm/mo 58.8–99.0
Air humidity59.7 % 56.7–62.0
Moisture balance-47.6 mm/mo -51.1–12.8
Vapour deficit660 Pa 591–728
Wind speed3.80 m/s 2.10–3.90
Cloud cover40.3 % 36.6–47.3
CHELSA 1981–2010, ~9 km grid, at location & month of 1 053 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.