Cheirodendron trigynum

(Gaudich.) A.Heller · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Araliaceae/Cheirodendron

At a glance

Occurrence records572

Data sources11

Biological traits18

DNA specimens4

eDNA detections4

Sources11 archives

Databases and archives Cheirodendron trigynum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility572 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF572 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Cheirodendron trigynum, also known as Ōlapa or common cheirodendron, is a species of flowering plant in the ginseng family, Araliaceae, that is endemic to Hawaii. It is a medium-sized tree, reaching a height of 12 – and a trunk diameter of 0.6 m. Ōlapa inhabits mixed mesic and wet forests at elevations of 310 – on all main islands, where it is an abundant understory tree.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry6

Leaf C:N ratio32 g/g

Leaf c480 mg/g

Leaf n12.9 mg/g

Leaf p1.04 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)10.64 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cheirodendron trigynum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences6

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSAY389030.1 ↗572 bp

ACGT

ACCCGAGGGACGAGGGGTGCGCAAGTTCCCCAAGTCGCGAACCCATGGTCGGGGATCGCCCTCGGGTCTTCCTCGTCCGAACAACGACCC …

Cheirodendron trigynum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cheirodendron trigynum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · book-fedorov · CCDB · Cave1956supp

CCDB · book-fedorov — Skottsberg 1955

CCDB · Cave1956supp — Skottsberg 1955

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type572 records

Wild obs. + sensor514

Museum / vouchered52

Fossil6

Range

Area of Occupancy AOO900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 219≤1 km 46≤10 km 26>10 km 126

417 georeferenced · 97 without coordinates

Open the mapobservation + sensor514

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 3≤1 km 4≤10 km 3>10 km 1

11 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	13
Vancouver, CA	12
HAWlocation not on record	5
Xiamen, CN	4
Honolulu, US	4
Tempe, US	3
CJBGlocation not on record	2
Auckland, NZ	2
Angwin, US	2
Bloomington, US	2
Wuzhou, CN	1
Flagstaff, US	1
Bronx, US	1

13 institutions · 52 of 52 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Cheirodendron trigynum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)