Cheiridopsis pillansii

L.Bolus · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Cheiridopsis

At a glance

Occurrence records44

Data sources9

Biological traits12

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Cheiridopsis pillansii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility44 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF44 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Aizoaceaeː Cheiridopis pillansii at Marsh Botanical Garden. Cheiridopsis pillansii is a species of plant native to South Africa, around Cape Town. It is a member of the family Aizoaceae. It is a low-growing leaf succulent. It has small cushion-like leaves, and a short stem.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.07 m

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max750 m

Elevation min400 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: succulent

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cheiridopsis pillansii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKKY631859.1 ↗744 bp

ACGT

CTTTGCATTTATTACGATTCTTTCTTTATGGGTATCATAATTGGAATAGTCTTATTACTTCAAAAGAATCCTTTTCTTTTTTTTCAAAAA …

Cheiridopsis pillansii voucher Powell 45 (NBG) maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cheiridopsis pillansii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–362n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hartmann, H. & M. Dehn. 1987. Monographien der Leipoldtiinae. VII. Monographie der Gattung Cheiridopsis (Mesembryanthemaceae). Bot. Jahrb. Syst. 108: 567–663.

CCDB · ipcn-api-dl — Albers, F. & R. HAAS. 1978. Karyosystematische Untersuchungen bei den Mesembryanthemaceae Fenzl emend. Herre et Volk. Bot. Jahrb. Syst. 99: 462–467.

2n 361×CCDB · book-fedorov

CCDB · book-fedorov — de Vos 1947

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type44 records

Wild obs. + sensor27

Museum / vouchered17

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 15>10 km 10

25 georeferenced · 2 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	6
University of Hamburglocation not on record	6
Cape Town, ZA	3
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
South African National Biodiversity Institutelocation not on record	1

5 institutions · 17 of 17 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Cheiridopsis pillansii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 16.6–16.6

Seasonal swing summer↔winter6.20 °C

Max temp (day)22.6 °C

Min temp (night)11.9 °C

Precipitation11.8 mm/mo

Air humidity54.6 %

Moisture balance-67.8 mm/mo

Vapour deficit855 Pa

Wind speed2.70 m/s

Cloud cover6.50 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)