Cheiridopsis denticulata

(Haw.) N.E.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Cheiridopsis

At a glance

Occurrence records365

Data sources10

Biological traits13

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Cheiridopsis denticulata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF365 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Cheiridopsis denticulata is a species in the genus Cheiridopsis. Cheiridopsis denticulata is native to South Africa and is described as rare. Its flowers are described as yellow.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.15 m

Life cycle & reproduction3

Dispersal typewater

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 200 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: succulent

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cheiridopsis denticulata has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

matKKY631850.1 ↗732 bp

ACGT

CTTTGCATTTATTACGATTCTTTCTTTATGGGTATCATAATTGGAATAGTCTTATTACTTCAAAAGAATCCTTTTCTTTTTTTTCAAAAA …

Cheiridopsis denticulata voucher Powell 9 (NBG) maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cheiridopsis denticulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–362n range36median36mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Albers, F. & R. HAAS. 1978. Karyosystematische Untersuchungen bei den Mesembryanthemaceae Fenzl emend. Herre et Volk. Bot. Jahrb. Syst. 99: 462–467.

CCDB · ipcn-api-dl — Hartmann, H. & M. Dehn. 1987. Monographien der Leipoldtiinae. VII. Monographie der Gattung Cheiridopsis (Mesembryanthemaceae). Bot. Jahrb. Syst. 108: 567–663.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type365 records

Wild obs. + sensor270

Museum / vouchered95

Range

Area of Occupancy AOO996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 169≤1 km 20≤10 km 12>10 km 43

244 georeferenced · 26 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 95 records without

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Hamburglocation not on record	51
Pretoria, ZA	38
Cape Town, ZA	3
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
University of Johannesburglocation not on record	1

5 institutions · 94 of 95 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Cheiridopsis denticulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 14.3–14.5

Seasonal swing summer↔winter7.90 °C

Max temp (day)20.2 °C 19.3–21.0

Min temp (night)10.1 °C 9.30–10.8

Precipitation28.5 mm/mo 16.4–40.5

Air humidity54.3 % 50.7–57.8

Moisture balance-74.7 mm/mo -91.8–-57.6

Vapour deficit752 Pa 698–805

Wind speed4.30 m/s 4.10–4.50

Cloud cover7.70 % 7.30–8.10

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)