Cheilosa montana

Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Cheilosa

At a glance

Occurrence records41

Data sources8

Biological traits13

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Cheilosa montana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Cheilosa is a monotypic plant genus of the family Euphorbiaceae first described as a genus in 1826.Blume, Carl Ludwig von. 1826. Bijdragen tot de flora van Nederlandsch Indië 613-614 in LatinTropicos Only one species is recognized: Cheilosa montana, native to Southeast Asia (Peninsular Malaysia, Borneo, Sumatra, Philippines, Java).Kew World Checklist of Selected Plant FamiliesGovaerts, R., Frodin, D.G. & Radcliffe-Smith, A. (2000). World Checklist and Bibliography of Euphorbiaceae (and Pandaceae) 1-4: 1-1622. The Board of Trustees of the Royal Botanic Gardens, Kew. formerly included moved to Trigonostemon Cheilosa whiteana Croizat, synonym of Trigonostemon whiteanus (Croizat) Airy Shaw

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max24 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density560 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cheilosa montana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences6

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ039760.1 ↗739 bp

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACCCGTTTCGAACC …

Cheilosa montana voucher M.J.E.Coode et al. 7842 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type41 records

Museum / vouchered41

Range

Area of Occupancy AOO120 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 41 records without

Open the institutions mapphysical evidence41

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	3

1 institutions · 3 of 41 vouchered records shown · 38 without an institution code

09Environmental DNA2 detections

Where the DNA of Cheilosa montana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)