Chasmanthe aethiopica

(L.) N.E.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Chasmanthe

At a glance

Occurrence records1 961

Data sources9

Biological traits28

DNA specimens5

eDNA detections4

Sources9 archives

Databases and archives Chasmanthe aethiopica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 961 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF1 961 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Chasmanthe aethiopica là một loài thực vật có hoa trong họ Diên vĩ. Loài này được (L.) N.E.Br. miêu tả khoa học đầu tiên năm 1932.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Leaf length max1 000 mm

Leaf width max50 mm

Leaf width min40 mm

Plant height max1.5 m

Plant height min0.25 m

Seed mass46.57 mg

Seed mass max47.87 mg

Seed mass min45.26 mg

Life cycle & reproduction7

Dehiscencedehiscent

Flower colourred

Flowering endMay

Flowering startFeb

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 525 m

Elevation min3 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits2

Inflorescencespike

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chasmanthe aethiopica has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences7

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKX783844.1 ↗552 bpEgypt · 2012

ACGT

AGTGCTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCGGAGTACGAAACCAAAGATACTGATATCTTGGCAGCA …

Chasmanthe aethiopica voucher Hosam00245 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Chasmanthe aethiopica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records20–322n range32median32mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Nakajima 1936

CCDB · book-atlas-flowering-plants — Nakajima 1936

2n 201×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GOLDBLATT, P. 1971. Cytological and morphological studies in the Southern African Iridaceae. J.S. African Bot. 37: 317-460.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 961 records

Wild obs. + sensor1 784

Museum / vouchered176

Cultivated / captive1

Origin

Native12

Introduced65

Range

Area of Occupancy AOO2 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 229≤1 km 240≤10 km 56>10 km 12

1 537 georeferenced · 247 without coordinates

Open the mapobservation + sensor1 784

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 3≤10 km 3>10 km 1

7 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence176

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	64
Cape Town, ZA	59
Cape Town, ZA	11
GHPG$location not on record	6
MAlocation not on record	5
Zürich, CH	4
Riverside, US	4
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	4
Durban, ZA	3
Irvine, US	2
MSB-3054location not on record	2
Bronx, US	1
Phyletisches Museum Jenalocation not on record	1
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	1
South African National Biodiversity Institutelocation not on record	1
MeiseBGlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
College of the Atlantic, Museumlocation not on record	1
València, ES	1
Alexandria Universitylocation not on record	1

20 institutions · 173 of 176 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Chasmanthe aethiopica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 16.5–16.5

Seasonal swing summer↔winter13.8 °C

Max temp (day)22.7 °C

Min temp (night)10.0 °C

Precipitation7.80 mm/mo

Air humidity54.6 %

Moisture balance-108 mm/mo

Vapour deficit852 Pa

Wind speed3.50 m/s

Cloud cover28.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chasmanthe aethiopica

At a glance

Sources9 archives

Size & morphology8

Life cycle & reproduction7

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

Other traits2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 961 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 961 records