Charpentiera elliptica

(Hillebr.) A.Heller · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Charpentiera

At a glance

Occurrence records38

Data sources4

Biological traits15

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Charpentiera elliptica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility38 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF38 records

DNA & barcodingNCBIsequences

01Narrative

Charpentiera elliptica, the ellipticleaf pāpala, is an endangered species of flowering tree in the family Amaranthaceae, endemic to the island of Kauai in Hawaii. It inhabits coastal mesic and mixed mesic forests at elevations of 250 –.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length max155 mm

Leaf length min50 mm

Leaf width max60 mm

Leaf width min20 mm

Plant height max6 m

Seed length max1.5 mm

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Charpentiera elliptica has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH766917.1 ↗337 bpUSA · 2017

ACGT

CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCTCCC …

Charpentiera elliptica voucher US:Gostel288 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor16

Museum / vouchered22

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 16

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	11
Honolulu, US	5
Bronx, US	2
Fullerton, US	1
Auckland, NZ	1
BISHlocation not on record	1

6 institutions · 21 of 22 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)