Chara virgata

Kütz · species

image placeholder — illustration coming later

Plantae/Charophyta/Charophyceae/Charales/Characeae/Chara

At a glance

Occurrence records10 432

Data sources8

Biological traits1

DNA specimens21

eDNA detections7

Sources8 archives

Databases and archives Chara virgata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 398 records↗

OBISOcean Biodiversity Information System34 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS10 432 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD · NCBI21 specimens

01Narrative

Chara virgata is slender, branched freshwater green alga.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat freshwateryes

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chara virgata has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes4

GenBank sequences10

eDNA detections7

Countries5

The DNA barcodea real sequence read deposited for this species

matKLN851494.1 ↗518 bp

ACGT

AAAGCTTTCTTCATTTACTAAAGAACATATTCAATTTAAAAAAAGAATTGTTGATTGAAGCATTCTATTGTGATAAATTTCATTTGATTG …

Chara virgata chloroplast partial matK gene for maturase K, isolate T88

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK10★rbcL★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type10 432 records

Wild obs. + sensor9 035

Museum / vouchered1 361

Cultivated / captive2

Other34

Origin

Native1 585

Range

Area of Occupancy AOO17 752 km²

Depth

0–200 m sunlit25

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.5 m · max 3 m · 25 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 3 560≤1 km 834≤10 km 4 228>10 km 5

8 627 georeferenced · 408 without coordinates

Open the mapobservation + sensor9 035

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 667≤1 km 218≤10 km 106>10 km 73

1 064 georeferenced · 297 without coordinates

Open the institutions mapphysical evidence1 361

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	567
Helsinki, FI	184
Metsähallituslocation not on record	98
South Kensington, GB	62
Uniwersytet Wrocławskilocation not on record	60
SLU Artdatabankenlocation not on record	43
BioFokuslocation not on record	35
Turku, FI	28
Trondheim, NO	27
LDlocation not on record	25
Bronx, US	25
Adam Mickiewicz University in Poznańlocation not on record	18
730location not on record	10
UNINE:NEUlocation not on record	7
BSBIlocation not on record	7
Oskarshamn, SE	6
Tartu, EE	5
TROMlocation not on record	4
CJBGlocation not on record	3
Burlington, US	3
BRNUlocation not on record	3
TUR-Alocation not on record	3
KMNlocation not on record	2
Norwegian Institute for Water Researchlocation not on record	2
Provincia di Livornolocation not on record	2
IPA/SPlocation not on record	2
Edmonton, CA	1
Lausanne, CH	1
Tilburg, NL	1
Anchorage, US	1
MFUlocation not on record	1
University of Birminghamlocation not on record	1
nbflocation not on record	1
Salzburg, AT	1
Moscow State Universitylocation not on record	1
Zürich, CH	1
Frankfurt am Main	1

37 institutions · 1 242 of 1 361 vouchered records shown · 118 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Chara virgata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.00 °C 1.10–3.40

Seasonal swing summer↔winter23.1 °C

Max temp (day)4.70 °C 3.20–6.40

Min temp (night)-0.1 °C -1.30–0.7

Precipitation63.3 mm/mo 62.0–69.5

Air humidity68.7 % 64.6–70.3

Moisture balance43.0 mm/mo 22.8–50.6

Vapour deficit238 Pa 200–328

Wind speed3.10 m/s 2.60–4.00

Cloud cover52.6 % 51.6–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chara virgata

At a glance

Sources8 archives

Habitat & environment1

At a glance

Record type10 432 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 432 records