Chara hornemannii

Wallman · species

image placeholder — illustration coming later

Plantae/Charophyta/Charophyceae/Charales/Characeae/Chara

At a glance

Occurrence records143

Data sources3

Biological traits0

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Chara hornemannii's data was compiled from.

GBIFGlobal Biodiversity Information Facility143 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF143 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chara hornemannii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKR080216.1 ↗6 603 bpPeru

ACGT

TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGACTAAGCCATGCACGTTTAAGTGTGAACACTTTGCATTGTGAAACTGC …

Chara hornemannii voucher NY:00739162 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type143 records

Wild obs. + sensor15

Museum / vouchered128

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 1>10 km 3

9 georeferenced · 6 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 2≤1 km 6≤10 km 19>10 km 12

39 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	76
LDlocation not on record	7
Ann Arbor, US	6
New Haven, US	4
Corvallis, US	4
Irvine, US	3
PHlocation not on record	3
College Park, US	2
Chapel Hill, US	2
Burlington, US	2
Miami, US	2
Butler Universitylocation not on record	1
WTUlocation not on record	1
Brown Universitylocation not on record	1
Champaign, US	1
University of Stellenboschlocation not on record	1
FLASlocation not on record	1
McWane Science Centerlocation not on record	1
Minia, EG	1

19 institutions · 119 of 128 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)